pycom17g18060

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
15541946 .. 15542279
334 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g18060.2

Sequence Viewer

Length: 270 bp
ATGGGTGAAAGGCTAGTTAGAGGATCCTTCTCCACACATGCACATATCGAACACAAATTGATTTCCATTTCAAATTTTCCTAGTTTCATTGAATTGGATGGAATACGTATCACAACCAAATTATCTTTCTCAAGTTCTCTATATGAAACGCATGATAAAGATACATATCAAAAGTCATTAAGTTTTATGAAAATCATAAGCATTGACAAGGCATTCGTAACTATGAACTGCATGATACTCTTGCCTAGAATTTACTTAACACAATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.23

Weight (kDa)

8.85

Isoelectric Point (pI)

32.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 18, 31
AcsI RAATTY 2 cut(s) 73, 249
AgsI TTSAA 2 cut(s) 72, 92
AjuI GAANNNNNNNTTGG 2 cut(s) 110, 142
AlwI GGATC 2 cut(s) 18, 31
ApoI RAATTY 2 cut(s) 73, 249
ArsI GACNNNNNNTTYG 2 cut(s) 197, 229
AsuHPI GGTGA 1 cut(s) 17
BamHI GGATCC 1 cut(s) 23
BccI CCATC 1 cut(s) 92
BfaI CTAG 3 cut(s) 14, 81, 246
BmiI GGNNCC 1 cut(s) 25
BpuEI CTTGAG 1 cut(s) 115
BsaAI YACGTR 1 cut(s) 107
BsaBI GATNNNNATC 1 cut(s) 165
Bse8I GATNNNNATC 1 cut(s) 165
BseGI GGATG 1 cut(s) 103
BseJI GATNNNNATC 1 cut(s) 165
BsmI GAATGC 1 cut(s) 212
Bsp143I GATC 1 cut(s) 23
BspHI TCATGA 1 cut(s) 266
BspLI GGNNCC 1 cut(s) 25
BspPI GGATC 2 cut(s) 18, 31
BssMI GATC 1 cut(s) 23
BstBAI YACGTR 1 cut(s) 107
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 1 cut(s) 26
BstMBI GATC 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 41
BstSNI TACGTA 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 23
BstYI RGATCY 1 cut(s) 23
BtsCI GGATG 1 cut(s) 103
CciI TCATGA 1 cut(s) 266
CviAII CATG 4 cut(s) 38, 152, 232, 267
CviJI RGCY 1 cut(s) 13
CviKI_1 RGCY 1 cut(s) 13
DpnI GATC 1 cut(s) 25
DpnII GATC 1 cut(s) 23
Eco105I TACGTA 1 cut(s) 107
FaeI CATG 4 cut(s) 41, 155, 235, 270
FatI CATG 4 cut(s) 37, 151, 231, 266
FokI GGATG 1 cut(s) 110
FspBI CTAG 3 cut(s) 14, 81, 246
Hin1II CATG 4 cut(s) 41, 155, 235, 270
HphI GGTGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 267
HpyAV CCTTC 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 41, 231
HpySE526I ACGT 1 cut(s) 106
Hsp92II CATG 4 cut(s) 41, 155, 235, 270
Kzo9I GATC 1 cut(s) 23
MaeI CTAG 3 cut(s) 14, 81, 246
MaeII ACGT 1 cut(s) 106
MaeIII GTNAC 1 cut(s) 217
MalI GATC 1 cut(s) 25
MboI GATC 1 cut(s) 23
MflI RGATCY 1 cut(s) 23
MluCI AATT 5 cut(s) 56, 73, 92, 119, 249
MnlI CCTC 1 cut(s) 14
MseI TTAA 2 cut(s) 179, 257
MslI CAYNNNNRTG 1 cut(s) 265
Mva1269I GAATGC 1 cut(s) 212
NdeII GATC 1 cut(s) 23
NlaIII CATG 4 cut(s) 41, 155, 235, 270
NlaIV GGNNCC 1 cut(s) 25
NspI RCATGY 1 cut(s) 41
PagI TCATGA 1 cut(s) 266
PctI GAATGC 1 cut(s) 212
Ppu21I YACGTR 1 cut(s) 107
PspN4I GGNNCC 1 cut(s) 25
PsuI RGATCY 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 265
SaqAI TTAA 2 cut(s) 179, 257
Sau3AI GATC 1 cut(s) 23
SetI ASST 1 cut(s) 109
SgeI CNNG 9 cut(s) 26, 50, 93, 144, 164, 220, 244, 253, 258
SmiMI CAYNNNNRTG 1 cut(s) 265
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
SnaBI TACGTA 1 cut(s) 107
Sse9I AATT 5 cut(s) 56, 73, 92, 119, 249
SspMI CTAG 3 cut(s) 14, 81, 246
TaiI ACGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 48
TasI AATT 5 cut(s) 56, 73, 92, 119, 249
Tru1I TTAA 2 cut(s) 179, 257
Tru9I TTAA 2 cut(s) 179, 257
TspDTI ATGAA 4 cut(s) 76, 159, 203, 239
XapI RAATTY 2 cut(s) 73, 249
XceI RCATGY 1 cut(s) 41
XspI CTAG 3 cut(s) 14, 81, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.