pycom13g27290

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
23647245 .. 23647882
638 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g27290.6

Sequence Viewer

Length: 396 bp
ATGACTCAAAATATTGGACGAATTCTAACTTACACACGAAATATAAAGGGGGAGGTGGTTTTTGACAAATTTAAAGTAAAAGCAAACAGATTTAAAGACTCTAAACAACTTTGGACGAAATTGGGTGTTTTAATGGATGGATGGCTAGCTAGAGGGTTCATCTCCACACATGACACATATGAATGGCAATGCCCCAAATTAATTGTGAACTTATTCTTATCAAGTTCCCTATATGAACTGTATGATAGAGATACATATCAAAGATCATTAAGTTCTATGAAAATCATAAGCATTGACATGACATTCTGTACAATCAATAATGCCCTACTCCCGAACTACTTATTTTCAGGGATAATTATCCATGACAACCCAATTAACACTAATTTAACCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

15.25

Weight (kDa)

9.14

Isoelectric Point (pI)

22.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 21, 68
AfaI GTAC 1 cut(s) 310
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
ApoI RAATTY 2 cut(s) 21, 68
AseI ATTAAT 1 cut(s) 200
Asp700I GAANNNNTTC 1 cut(s) 212
AsuNHI GCTAGC 1 cut(s) 145
BccI CCATC 2 cut(s) 131, 135
BfaI CTAG 2 cut(s) 146, 150
BmtI GCTAGC 1 cut(s) 149
BsaBI GATNNNNATC 2 cut(s) 255, 356
Bse3DI GCAATG 1 cut(s) 194
Bse8I GATNNNNATC 2 cut(s) 255, 356
BseGI GGATG 2 cut(s) 142, 146
BseJI GATNNNNATC 2 cut(s) 255, 356
BseMI GCAATG 1 cut(s) 194
Bsp1407I TGTACA 1 cut(s) 308
Bsp143I GATC 1 cut(s) 263
BspOI GCTAGC 1 cut(s) 149
BsrDI GCAATG 1 cut(s) 194
BsrGI TGTACA 1 cut(s) 308
BssMI GATC 1 cut(s) 263
Bst4CI ACNGT 1 cut(s) 240
BstAUI TGTACA 1 cut(s) 308
BstC8I GCNNGC 1 cut(s) 147
BstF5I GGATG 2 cut(s) 142, 146
BstKTI GATC 1 cut(s) 266
BstMBI GATC 1 cut(s) 263
BtsCI GGATG 2 cut(s) 142, 146
Cac8I GCNNGC 1 cut(s) 147
Csp6I GTAC 1 cut(s) 309
CviAII CATG 3 cut(s) 170, 298, 362
CviJI RGCY 2 cut(s) 145, 149
CviKI_1 RGCY 2 cut(s) 145, 149
CviQI GTAC 1 cut(s) 309
DpnI GATC 1 cut(s) 265
DpnII GATC 1 cut(s) 263
DraI TTTAAA 2 cut(s) 73, 94
EcoRI GAATTC 1 cut(s) 21
FaeI CATG 3 cut(s) 173, 301, 365
FatI CATG 3 cut(s) 169, 297, 361
FauNDI CATATG 1 cut(s) 178
FokI GGATG 2 cut(s) 149, 153
FspBI CTAG 2 cut(s) 146, 150
Hin1II CATG 3 cut(s) 173, 301, 365
HinfI GANTC 2 cut(s) 4, 98
Hpy166II GTNNAC 1 cut(s) 208
Hpy188III TCNNGA 1 cut(s) 331
Hpy8I GTNNAC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 240
Hsp92II CATG 3 cut(s) 173, 301, 365
Kzo9I GATC 1 cut(s) 263
LpnPI CCDG 1 cut(s) 333
MaeI CTAG 2 cut(s) 146, 150
MalI GATC 1 cut(s) 265
MboI GATC 1 cut(s) 263
MluCI AATT 8 cut(s) 21, 68, 119, 197, 201, 354, 372, 382
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 2 cut(s) 46, 146
MroXI GAANNNNTTC 1 cut(s) 212
MseI TTAA 7 cut(s) 72, 93, 131, 200, 269, 375, 386
MslI CAYNNNNRTG 2 cut(s) 181, 296
NdeI CATATG 1 cut(s) 178
NdeII GATC 1 cut(s) 263
NheI GCTAGC 1 cut(s) 145
NlaIII CATG 3 cut(s) 173, 301, 365
PdmI GAANNNNTTC 1 cut(s) 212
PleI GAGTC 1 cut(s) 92
PpsI GAGTC 1 cut(s) 92
PshBI ATTAAT 1 cut(s) 200
RsaI GTAC 1 cut(s) 310
RsaNI GTAC 1 cut(s) 309
RseI CAYNNNNRTG 2 cut(s) 181, 296
SaqAI TTAA 7 cut(s) 72, 93, 131, 200, 269, 375, 386
Sau3AI GATC 1 cut(s) 263
SchI GAGTC 1 cut(s) 92
SetI ASST 2 cut(s) 57, 151
SgeI CNNG 9 cut(s) 48, 158, 162, 182, 234, 310, 343, 360, 374
SmiMI CAYNNNNRTG 2 cut(s) 181, 296
Sse9I AATT 8 cut(s) 21, 68, 119, 197, 201, 354, 372, 382
SspI AATATT 1 cut(s) 13
SspMI CTAG 2 cut(s) 146, 150
TaaI ACNGT 1 cut(s) 240
TasI AATT 8 cut(s) 21, 68, 119, 197, 201, 354, 372, 382
TatI WGTACW 1 cut(s) 308
Tru1I TTAA 7 cut(s) 72, 93, 131, 200, 269, 375, 386
Tru9I TTAA 7 cut(s) 72, 93, 131, 200, 269, 375, 386
TspDTI ATGAA 4 cut(s) 148, 195, 249, 293
VspI ATTAAT 1 cut(s) 200
XapI RAATTY 2 cut(s) 21, 68
XmnI GAANNNNTTC 1 cut(s) 212
XspI CTAG 2 cut(s) 146, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.