pycom12424g00150

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012424
OG0000608
Physical Location & Seq
Forward (+)
75818 .. 76822
1005 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12424g00150.4

Sequence Viewer

Length: 723 bp
ATGAATTTAAGACTTAAACAATCAGATTGCTTAGACAAACTAAAAGAGGGTCCTTCTCCACACATGACATATGCATACAAACCAATTTCTATAACTGTGAAAAGGGATACGCATCACAACCAAATTATCCTTATCAAGTTCCCTAACTATGAAAATCATGATAGAAAGACATATCAAAGGTCATTATGTTCTTTGAAAACCATAAGCATTGACAAGATATTCGTAACTATGAAAAGCATGATACTCATACCAAGGATTTACTTAAAACTCCCCCTATGTGGTACGGCACAAAGGCTTCTCCCTTCCTTCATTCTCCTAAAAACTCCCCCCTATGTGGTGCGGCATATATGTGTATATATAGGACTAGGGGCAGAAACCAAGGAGAATAATAAGAAGGTGTGGCAGATCGATCTTAAGGCTTCTAGAATAGGGTATTGTGATAGGTTTCTAGAAGGACAAGGGATAAGATATGTAGTCATCTTTGCACCTGGAATTAAGAAGGTTGTTTGGATAATGTTCCATGTTTCTTGCTCTTTCCTTATCTTCTTTGTCTTAAACTTGTTTCTCCAGATTTGTAGCATGTTCCTAGCCTCTTTTGACTTCAAATTCGTCCATCCACCTTGCTCCATATGCAAGCTATCCATTCCAAGCCCAAAACTACTCCAAATAGCTCCAAAATGCACTTTCTTGCCTTTTTTGCCATTAGGACCTACAAACACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

241

Amino Acids

27.64

Weight (kDa)

9.66

Isoelectric Point (pI)

33.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 340
AcsI RAATTY 2 cut(s) 4, 605
AfaI GTAC 1 cut(s) 283
AfiI CCNNNNNNNGG 2 cut(s) 278, 334
AflII CTTAAG 1 cut(s) 413
AgsI TTSAA 2 cut(s) 196, 604
AjnI CCWGG 1 cut(s) 487
AluBI AGCT 2 cut(s) 637, 671
AluI AGCT 2 cut(s) 637, 671
ApoI RAATTY 2 cut(s) 4, 605
ArsI GACNNNNNNTTYG 4 cut(s) 203, 235, 590, 622
AspS9I GGNCC 2 cut(s) 50, 707
AvaII GGWCC 2 cut(s) 50, 707
BccI CCATC 1 cut(s) 621
BceAI ACGGC 1 cut(s) 300
BciT130I CCWGG 1 cut(s) 489
BciVI GTATCC 1 cut(s) 100
BfaI CTAG 4 cut(s) 365, 423, 449, 587
BfrI CTTAAG 1 cut(s) 413
BfuI GTATCC 1 cut(s) 100
BisI GCNGC 1 cut(s) 341
BlsI GCNGC 1 cut(s) 342
Bme1390I CCNGG 1 cut(s) 489
Bme18I GGWCC 2 cut(s) 50, 707
BmgT120I GGNCC 2 cut(s) 50, 707
BmiI GGNNCC 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 489
BmsI GCATC 1 cut(s) 121
BpmI CTGGAG 1 cut(s) 551
Bsa29I ATCGAT 1 cut(s) 408
BsaBI GATNNNNATC 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 251, 378
Bsc4I CCNNNNNNNGG 2 cut(s) 278, 334
Bse8I GATNNNNATC 1 cut(s) 111
BseBI CCWGG 1 cut(s) 489
BseCI ATCGAT 1 cut(s) 408
BseDI CCNNGG 2 cut(s) 251, 378
BseGI GGATG 1 cut(s) 613
BseJI GATNNNNATC 1 cut(s) 111
BseLI CCNNNNNNNGG 2 cut(s) 278, 334
BshVI ATCGAT 1 cut(s) 408
BslI CCNNNNNNNGG 2 cut(s) 278, 334
Bsp143I GATC 2 cut(s) 405, 409
BspACI CCGC 1 cut(s) 340
BspDI ATCGAT 1 cut(s) 408
BspHI TCATGA 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 51
BspTI CTTAAG 1 cut(s) 413
BssECI CCNNGG 2 cut(s) 251, 378
BssMI GATC 2 cut(s) 405, 409
BssT1I CCWWGG 2 cut(s) 251, 378
Bst2UI CCWGG 1 cut(s) 489
Bst4CI ACNGT 1 cut(s) 97
BstAFI CTTAAG 1 cut(s) 413
BstC8I GCNNGC 1 cut(s) 635
BstDEI CTNAG 1 cut(s) 31
BstF5I GGATG 1 cut(s) 613
BstKTI GATC 2 cut(s) 408, 412
BstMBI GATC 2 cut(s) 405, 409
BstMWI GCNNNNNNNGC 2 cut(s) 630, 697
BstNI CCWGG 1 cut(s) 489
BstNSI RCATGY 1 cut(s) 583
BstSCI CCNGG 1 cut(s) 487
Bsu15I ATCGAT 1 cut(s) 408
BsuI GTATCC 1 cut(s) 100
BsuTUI ATCGAT 1 cut(s) 408
BtsCI GGATG 1 cut(s) 613
Cac8I GCNNGC 1 cut(s) 635
CciI TCATGA 1 cut(s) 157
Cfr13I GGNCC 2 cut(s) 50, 707
ClaI ATCGAT 1 cut(s) 408
Csp6I GTAC 1 cut(s) 282
CviAII CATG 6 cut(s) 64, 158, 238, 521, 580, 720
CviJI RGCY 6 cut(s) 295, 419, 590, 637, 651, 671
CviKI_1 RGCY 6 cut(s) 295, 419, 590, 637, 651, 671
CviQI GTAC 1 cut(s) 282
DdeI CTNAG 1 cut(s) 31
DpnI GATC 2 cut(s) 407, 411
DpnII GATC 2 cut(s) 405, 409
Eco130I CCWWGG 2 cut(s) 251, 378
Eco47I GGWCC 2 cut(s) 50, 707
EcoO109I RGGNCCY 2 cut(s) 50, 707
EcoRII CCWGG 1 cut(s) 487
EcoT14I CCWWGG 2 cut(s) 251, 378
EcoT22I ATGCAT 1 cut(s) 76
ErhI CCWWGG 2 cut(s) 251, 378
FaeI CATG 6 cut(s) 67, 161, 241, 524, 583, 723
FatI CATG 6 cut(s) 63, 157, 237, 520, 579, 719
FauNDI CATATG 2 cut(s) 70, 629
Fnu4HI GCNGC 1 cut(s) 341
FokI GGATG 1 cut(s) 600
Fsp4HI GCNGC 1 cut(s) 341
FspBI CTAG 4 cut(s) 365, 423, 449, 587
GluI GCNGC 1 cut(s) 341
GsuI CTGGAG 1 cut(s) 551
Hin1II CATG 6 cut(s) 67, 161, 241, 524, 583, 723
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 4 cut(s) 158, 423, 449, 568
HpyAV CCTTC 6 cut(s) 63, 312, 316, 388, 446, 493
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4V TGCA 4 cut(s) 74, 485, 633, 681
HpyF10VI GCNNNNNNNGC 2 cut(s) 630, 697
HpyF3I CTNAG 1 cut(s) 31
Hsp92II CATG 6 cut(s) 67, 161, 241, 524, 583, 723
Kzo9I GATC 2 cut(s) 405, 409
LmnI GCTCC 2 cut(s) 629, 676
LpnPI CCDG 3 cut(s) 474, 501, 581
LweI GCATC 1 cut(s) 121
MaeI CTAG 4 cut(s) 365, 423, 449, 587
MaeIII GTNAC 1 cut(s) 223
MalI GATC 2 cut(s) 407, 411
MboI GATC 2 cut(s) 405, 409
MboII GAAGA 1 cut(s) 535
MluCI AATT 5 cut(s) 4, 84, 123, 492, 605
MnlI CCTC 2 cut(s) 40, 601
Mph1103I ATGCAT 1 cut(s) 76
MseI TTAA 6 cut(s) 8, 15, 263, 414, 495, 554
MslI CAYNNNNRTG 1 cut(s) 348
MspCI CTTAAG 1 cut(s) 413
MspR9I CCNGG 1 cut(s) 489
MvaI CCWGG 1 cut(s) 489
MwoI GCNNNNNNNGC 2 cut(s) 630, 697
NdeI CATATG 2 cut(s) 70, 629
NdeII GATC 2 cut(s) 405, 409
NlaIII CATG 6 cut(s) 67, 161, 241, 524, 583, 723
NlaIV GGNNCC 1 cut(s) 51
NsiI ATGCAT 1 cut(s) 76
NspI RCATGY 1 cut(s) 583
PagI TCATGA 1 cut(s) 157
PkrI GCNGC 1 cut(s) 342
PpuMI RGGWCCY 2 cut(s) 50, 707
Psp5II RGGWCCY 2 cut(s) 50, 707
Psp6I CCWGG 1 cut(s) 487
PspGI CCWGG 1 cut(s) 487
PspN4I GGNNCC 1 cut(s) 51
PspPI GGNCC 2 cut(s) 50, 707
PspPPI RGGWCCY 2 cut(s) 50, 707
RsaI GTAC 1 cut(s) 283
RsaNI GTAC 1 cut(s) 282
RseI CAYNNNNRTG 1 cut(s) 348
SaqAI TTAA 6 cut(s) 8, 15, 263, 414, 495, 554
SatI GCNGC 1 cut(s) 341
Sau3AI GATC 2 cut(s) 405, 409
Sau96I GGNCC 2 cut(s) 50, 707
ScrFI CCNGG 1 cut(s) 489
SetI ASST 9 cut(s) 182, 399, 446, 490, 504, 622, 639, 673, 712
SfaNI GCATC 1 cut(s) 121
SinI GGWCC 2 cut(s) 50, 707
SmiMI CAYNNNNRTG 1 cut(s) 348
SmlI CTYRAG 1 cut(s) 413
SmoI CTYRAG 1 cut(s) 413
Sse9I AATT 5 cut(s) 4, 84, 123, 492, 605
SsiI CCGC 1 cut(s) 340
SspMI CTAG 4 cut(s) 365, 423, 449, 587
StyD4I CCNGG 1 cut(s) 487
StyI CCWWGG 2 cut(s) 251, 378
TaaI ACNGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 408
TasI AATT 5 cut(s) 4, 84, 123, 492, 605
TauI GCSGC 1 cut(s) 343
Tru1I TTAA 6 cut(s) 8, 15, 263, 414, 495, 554
Tru9I TTAA 6 cut(s) 8, 15, 263, 414, 495, 554
TspDTI ATGAA 4 cut(s) 17, 165, 245, 298
Vha464I CTTAAG 1 cut(s) 413
VpaK11BI GGWCC 2 cut(s) 50, 707
XapI RAATTY 2 cut(s) 4, 605
XbaI TCTAGA 2 cut(s) 422, 448
XceI RCATGY 1 cut(s) 583
XspI CTAG 4 cut(s) 365, 423, 449, 587
Zsp2I ATGCAT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.