pycom13g25530

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22305425 .. 22306291
867 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25530.1

Sequence Viewer

Length: 558 bp
ATGACTCAAAACAAACTAAAAAGACTCAAAACACACAAACTAATAAAAGGGGATTGGACTTTGGACGAAATTAAGGTAAAACCAAGCAGATTGGGTGAATGTCTAGCTAGAGGGTTCATCTCCACACATGACACATATGCATACAAATCAATTTCCAGTTATTATTCATTTAAACCACGAATGACAACGCCACAATTCATTGAATTAGATGGAATACGCATCGCAAACAAATTATCTTCCTCAAGTTCCCTATATGAAACGCATGATAGAGATACATATCAAAAGTCATTAAGTTCTATGAAAATCGTAAGCATTGACAAGGCATTCATCACTATGAAACGCATGAGACTCATACCAAGGATTTACTTAACACGATTACCCCCTTATACTCTAGCATCAAATTCATGCATGCAAATTAAGTGTCGACCCCCAACCAGAATACATAAGCAAATAATAAATTCATATAAAATATATAATCATGGCTCGAATTTACCTCCAACTAAAAAGAAATTAGTTCCTCATGTTCGCAAAACAATGATAATTAAACTTAAACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

186

Amino Acids

21.59

Weight (kDa)

10.24

Isoelectric Point (pI)

30.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 424
AcsI RAATTY 3 cut(s) 400, 457, 487
AgsI TTSAA 1 cut(s) 203
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
Alw26I GTCTC 1 cut(s) 340
ApoI RAATTY 3 cut(s) 400, 457, 487
ArsI GACNNNNNNTTYG 2 cut(s) 406, 438
AsuHPI GGTGA 1 cut(s) 107
BccI CCATC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 340
BfaI CTAG 3 cut(s) 104, 108, 392
BmsI GCATC 2 cut(s) 228, 404
BpuEI CTTGAG 1 cut(s) 226
BsaBI GATNNNNATC 1 cut(s) 276
BsaJI CCNNGG 1 cut(s) 356
Bse1I ACTGG 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 356
BseJI GATNNNNATC 1 cut(s) 276
BseNI ACTGG 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 340
BsmI GAATGC 1 cut(s) 323
BsrI ACTGG 1 cut(s) 156
BssECI CCNNGG 1 cut(s) 356
BssT1I CCWWGG 1 cut(s) 356
BstC8I GCNNGC 1 cut(s) 410
BstMAI GTCTC 1 cut(s) 340
BstNSI RCATGY 1 cut(s) 412
BtgZI GCGATG 1 cut(s) 205
Cac8I GCNNGC 1 cut(s) 410
CviAII CATG 7 cut(s) 128, 263, 343, 405, 409, 479, 521
CviJI RGCY 2 cut(s) 107, 483
CviKI_1 RGCY 2 cut(s) 107, 483
DraI TTTAAA 1 cut(s) 172
Eco130I CCWWGG 1 cut(s) 356
EcoT14I CCWWGG 1 cut(s) 356
EcoT22I ATGCAT 2 cut(s) 142, 410
ErhI CCWWGG 1 cut(s) 356
FaeI CATG 7 cut(s) 131, 266, 346, 408, 412, 482, 524
FatI CATG 7 cut(s) 127, 262, 342, 404, 408, 478, 520
FauNDI CATATG 1 cut(s) 136
FblI GTMKAC 1 cut(s) 424
FspBI CTAG 3 cut(s) 104, 108, 392
Hin1II CATG 7 cut(s) 131, 266, 346, 408, 412, 482, 524
HincII GTYRAC 1 cut(s) 425
HindII GTYRAC 1 cut(s) 425
HinfI GANTC 3 cut(s) 4, 24, 348
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 425
Hpy8I GTNNAC 1 cut(s) 425
HpyCH4V TGCA 3 cut(s) 140, 408, 412
Hsp92II CATG 7 cut(s) 131, 266, 346, 408, 412, 482, 524
LpnPI CCDG 2 cut(s) 169, 448
LweI GCATC 2 cut(s) 228, 404
MaeI CTAG 3 cut(s) 104, 108, 392
MboII GAAGA 1 cut(s) 228
MlyI GAGTC 2 cut(s) 18, 342
MmeI TCCRAC 1 cut(s) 521
MnlI CCTC 4 cut(s) 104, 250, 504, 528
Mph1103I ATGCAT 2 cut(s) 142, 410
MseI TTAA 8 cut(s) 72, 171, 290, 368, 417, 543, 549, 556
MslI CAYNNNNRTG 1 cut(s) 332
Mva1269I GAATGC 1 cut(s) 323
NdeI CATATG 1 cut(s) 136
NlaIII CATG 7 cut(s) 131, 266, 346, 408, 412, 482, 524
NsiI ATGCAT 2 cut(s) 142, 410
NspI RCATGY 1 cut(s) 412
PaeI GCATGC 1 cut(s) 412
PctI GAATGC 1 cut(s) 323
PleI GAGTC 2 cut(s) 18, 342
PpsI GAGTC 2 cut(s) 18, 342
RseI CAYNNNNRTG 1 cut(s) 332
SalI GTCGAC 1 cut(s) 423
SaqAI TTAA 8 cut(s) 72, 171, 290, 368, 417, 543, 549, 556
SchI GAGTC 2 cut(s) 18, 342
SetI ASST 3 cut(s) 78, 109, 496
SfaNI GCATC 2 cut(s) 228, 404
SmiMI CAYNNNNRTG 1 cut(s) 332
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
SphI GCATGC 1 cut(s) 412
SspMI CTAG 3 cut(s) 104, 108, 392
StyI CCWWGG 1 cut(s) 356
TaqI TCGA 2 cut(s) 424, 485
Tru1I TTAA 8 cut(s) 72, 171, 290, 368, 417, 543, 549, 556
Tru9I TTAA 8 cut(s) 72, 171, 290, 368, 417, 543, 549, 556
TspDTI ATGAA 9 cut(s) 106, 156, 187, 270, 314, 316, 350, 393, 450
XapI RAATTY 3 cut(s) 400, 457, 487
XceI RCATGY 1 cut(s) 412
XmiI GTMKAC 1 cut(s) 424
XspI CTAG 3 cut(s) 104, 108, 392
Zsp2I ATGCAT 2 cut(s) 142, 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.