pycom1654g00090

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001654
OG0000608
Physical Location & Seq
Forward (+)
76001 .. 78320
2320 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1654g00090.2

Sequence Viewer

Length: 216 bp
ATGAATTGGATGGGACAGCGTTATGCGCATACACAATTCAAAACATTCTCCAAAAGTCCTTTACGTAAAAAGCATAATAAAGATACAATCAACGATCGATTAAGCAACATGAAAACTATAAGTGTTGACGAGGCATTCGTTACTATGATGAGCATGAAACTAGTGCCAAGAATTCATTTAACGCGATTGTTTATAAGCAACCTCCACTACTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.5

Weight (kDa)

10.5

Isoelectric Point (pI)

32.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 194
Acc16I TGCGCA 1 cut(s) 27
AccII CGCG 1 cut(s) 184
AcsI RAATTY 1 cut(s) 171
AgsI TTSAA 1 cut(s) 40
AhlI ACTAGT 1 cut(s) 160
ApoI RAATTY 1 cut(s) 171
ArsI GACNNNNNNTTYG 2 cut(s) 119, 151
AspLEI GCGC 1 cut(s) 28
BccI CCATC 1 cut(s) 4
BcuI ACTAGT 1 cut(s) 160
BfaI CTAG 1 cut(s) 161
Bsa29I ATCGAT 1 cut(s) 97
BsaAI YACGTR 1 cut(s) 65
BseCI ATCGAT 1 cut(s) 97
BseGI GGATG 1 cut(s) 15
Bsh1236I CGCG 1 cut(s) 184
Bsh1285I CGRYCG 1 cut(s) 97
BshVI ATCGAT 1 cut(s) 97
BsiEI CGRYCG 1 cut(s) 97
BslFI GGGAC 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 27
BsmI GAATGC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 94
BspDI ATCGAT 1 cut(s) 97
BspFNI CGCG 1 cut(s) 184
BssMI GATC 1 cut(s) 94
BstBAI YACGTR 1 cut(s) 65
BstF5I GGATG 1 cut(s) 15
BstFNI CGCG 1 cut(s) 184
BstHHI GCGC 1 cut(s) 28
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstMCI CGRYCG 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstSNI TACGTA 1 cut(s) 65
BstUI CGCG 1 cut(s) 184
Bsu15I ATCGAT 1 cut(s) 97
BsuTUI ATCGAT 1 cut(s) 97
BtsCI GGATG 1 cut(s) 15
CfoI GCGC 1 cut(s) 28
ClaI ATCGAT 1 cut(s) 97
CviAII CATG 2 cut(s) 109, 154
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco105I TACGTA 1 cut(s) 65
EcoRI GAATTC 1 cut(s) 171
FaeI CATG 2 cut(s) 112, 157
FaiI YATR 8 cut(s) 24, 30, 75, 110, 119, 146, 155, 194
FaqI GGGAC 1 cut(s) 27
FatI CATG 2 cut(s) 108, 153
FokI GGATG 1 cut(s) 22
FspAI RTGCGCAY 1 cut(s) 27
FspBI CTAG 1 cut(s) 161
FspEI CC 4 cut(s) 64, 72, 116, 180
FspI TGCGCA 1 cut(s) 27
GlaI GCGC 1 cut(s) 27
HhaI GCGC 1 cut(s) 28
Hin1II CATG 2 cut(s) 112, 157
Hin6I GCGC 1 cut(s) 26
HinP1I GCGC 1 cut(s) 26
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 127
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
HpySE526I ACGT 1 cut(s) 64
Hsp92II CATG 2 cut(s) 112, 157
HspAI GCGC 1 cut(s) 26
Kzo9I GATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 161
MaeII ACGT 1 cut(s) 64
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MluCI AATT 3 cut(s) 4, 35, 171
MnlI CCTC 2 cut(s) 124, 212
MseI TTAA 2 cut(s) 101, 179
Mva1269I GAATGC 1 cut(s) 134
MvnI CGCG 1 cut(s) 184
MwoI GCNNNNNNNGC 1 cut(s) 25
NdeII GATC 1 cut(s) 94
NlaIII CATG 2 cut(s) 112, 157
NsbI TGCGCA 1 cut(s) 27
PcsI WCGNNNNNNNCGW 1 cut(s) 135
PctI GAATGC 1 cut(s) 134
Ple19I CGATCG 1 cut(s) 97
Ppu21I YACGTR 1 cut(s) 65
PsiI TTATAA 1 cut(s) 194
PvuI CGATCG 1 cut(s) 97
SaqAI TTAA 2 cut(s) 101, 179
Sau3AI GATC 1 cut(s) 94
SetI ASST 2 cut(s) 67, 204
SgeI CNNG 6 cut(s) 121, 142, 166, 173, 180, 195
SnaBI TACGTA 1 cut(s) 65
SpeI ACTAGT 1 cut(s) 160
Sse9I AATT 3 cut(s) 4, 35, 171
SspMI CTAG 1 cut(s) 161
TaiI ACGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 97
TasI AATT 3 cut(s) 4, 35, 171
Tru1I TTAA 2 cut(s) 101, 179
Tru9I TTAA 2 cut(s) 101, 179
TspDTI ATGAA 4 cut(s) 17, 125, 164, 170
XapI RAATTY 1 cut(s) 171
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.