Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0000608

Physical Location & Seq

Genomic Coordinates Forward (+)

20916996 .. 20918938

Gene Structure 1943 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g23290.8

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1275 bp

ATGCACTACATATTCTTGATTAGGAACCAAAGTTGCACATCACAATTAGCATATCTAAGTGAAACAAACCCAAGAAATAACAATGGTGAAATCGAATCTCTAGCTACATCTCTATTTGTGCTATCTCATTTCATTAGTTTTACAATCTGTCATTTATTAGAAATCATTTTAGTTTGTGTTTTTAAGAGTCTTGAGTCAATTTATTACCCAATTTTGTCCAAAGTAACCAAAGTGCTCAAATCTGCCCAGAAAGTGATTTTAAGTGTTTTAAAGTTTAGTTTTGCATTCTTTGAGTCTAGTATAGTGTTTCATATTGTTATTTTACAACGATCCCTACTTGCACCTATACTACAATTGTCAAAAAGAGGGTTTAATTTATGCGCGTATAATTCCCGCATCAATCTAAGATGTTATGCATTCAATCCAGTTATCTTGTACTTTAGATTTGATGGACTTGTTTTGACCCACAGATTGAGTGTTCTTTTATCATTATGGCATTATGAACTGCATTGTTCAGCTATATGGTGTGTGTTTGACACGTGTTTCACTTCCAAGCCTTGGGAAGTCTTCTTGAAGGCTATAATTACAAAGTTGTTGTCCGATATCACACTTCATCCTCAGACAAACGCCCAGTGTGAACGAACTATTAGGACCTTCGTGGCATGTTGCATTTCCCCGTTCTATAATTTTAGCATGATTATAGTACACTTATTTTTGTTAGAGTTGCGTGTAATTGTGGTTACACTTTGGGTTTTTGGGTATGTATTGCAAACAGGTATTCAAATGATCGAATTGCGAGGTAGCAAAATTGCACCGGATGATTTAGGTGTATTTCCCAATGAGGGGCATGATGGTACTATTGCATCCTTGGGAATTTGTCATTTGTTTATTGAGACAATAGTGAGTTGTTGGTATTGCGGGCTGCAGACCGTAATATCGATGACTTATTCATTGGGTTCGTTAAACAAGTGGATAAGTAGGCCGTCTACGTTACTATTTTTATTTCTTCATTTAGTTATTTACTTATTGTTTGGACTTGACCCAAAGATACTACATTACAATTATTTTAACTTTATTTTATCATATACATATATTGACATTATATTATTATACATATACGCATCTCTGACTTTTTGTTTTTATAAAGGCATGAAAGAGGAATCATTGCAATCCGATCGTGACAAAATAGCATTCTCTTTTATGCAACATATTTTATGTATAACAAGTGATTTCAAATTTCGGGGACCAAATTTTTTTAAGATGGGTAGATTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

425

Amino Acids

49.04

Weight (kDa)

8.69

Isoelectric Point (pI)

45.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000608)

Species	Orthologous Gene IDs
malus_domestica	MD01G1168300.v1.1 MD07G1127200.v1.1
prunus_persica	Prupe.5G065800_v2.0.a1
pyrus_communis	pycom01g00450 pycom01g00530 pycom01g00860 pycom01g01270 pycom01g01320 pycom01g01350 pycom01g01370 pycom01g01420 pycom01g01440 pycom01g01750 pycom01g02240 pycom01g02250 pycom01g02980 pycom01g03610 pycom01g04360 pycom03g18640 pycom05g08190 pycom05g08210 pycom05g08250 pycom05g08270 pycom05g22500 pycom11g13900 pycom12424g00150 pycom12426g00120 pycom12426g00140 pycom12426g00190 pycom12426g00200 pycom12426g00480 pycom1256g00170 pycom1256g00250 pycom12659g00080 pycom12659g00170 pycom12659g00200 pycom12661g00070 pycom12661g00120 pycom12g04960 pycom1341g00040 pycom13g23150 pycom13g23290 pycom13g24030 pycom13g24710 pycom13g25450 pycom13g25530 pycom13g25630 pycom13g25650 pycom13g25850 pycom13g25920 pycom13g26130 pycom13g26150 pycom13g26180 pycom13g26190 pycom13g26310 pycom13g27290 pycom13g28010 pycom13g28180 pycom1654g00090 pycom1654g00100 pycom17g16670 pycom17g16980 pycom17g17190 pycom17g17210 pycom17g17290 pycom17g17520 pycom17g17750 pycom17g17770 pycom17g17820 pycom17g18030 pycom17g18060 pycom17g18070 pycom17g18240 pycom280g00030 pycom436g00360 pycom520g00110 pycom520g01100 pycom808g00240 pycom808g00490 pycom808g00610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1143
AccB7I	CCANNNNNTGG	1 cut(s)	558
AccI	GTMKAC	1 cut(s)	986
AccII	CGCG	1 cut(s)	383
AciI	CCGC	2 cut(s)	394, 918
AclWI	GGATC	1 cut(s)	324
AcsI	RAATTY	3 cut(s)	873, 1235, 1249
AcvI	CACGTG	1 cut(s)	540
AfaI	GTAC	3 cut(s)	437, 705, 856
AfiI	CCNNNNNNNGG	3 cut(s)	558, 842, 843
AflIII	ACRYGT	2 cut(s)	537, 539
AgsI	TTSAA	4 cut(s)	421, 574, 782, 1234
AluBI	AGCT	2 cut(s)	104, 518
AluI	AGCT	2 cut(s)	104, 518
Alw21I	GWGCWC	1 cut(s)	237
Alw26I	GTCTC	1 cut(s)	887
AlwI	GGATC	1 cut(s)	324
AoxI	GGCC	1 cut(s)	980
ApeKI	GCWGC	1 cut(s)	922
ApoI	RAATTY	3 cut(s)	873, 1235, 1249
ArsI	GACNNNNNNTTYG	2 cut(s)	581, 613
AspLEI	GCGC	1 cut(s)	383
AspS9I	GGNCC	2 cut(s)	651, 1244
AsuHPI	GGTGA	1 cut(s)	98
AvaII	GGWCC	2 cut(s)	651, 1244
BbrPI	CACGTG	1 cut(s)	540
BbsI	GAAGAC	1 cut(s)	559
Bbv12I	GWGCWC	1 cut(s)	237
BbvI	GCAGC	1 cut(s)	909
BccI	CCATC	3 cut(s)	443, 845, 1255
BceAI	ACGGC	1 cut(s)	967
BcgI	CGANNNNNNTGC	2 cut(s)	1157, 1191
BcoDI	GTCTC	1 cut(s)	887
BfaI	CTAG	2 cut(s)	101, 297
BfmI	CTRYAG	1 cut(s)	923
BisI	GCNGC	1 cut(s)	923
BlsI	GCNGC	1 cut(s)	924
Bme18I	GGWCC	2 cut(s)	651, 1244
BmgT120I	GGNCC	2 cut(s)	651, 1244
BmiI	GGNNCC	2 cut(s)	26, 1245
BmrI	ACTGGG	1 cut(s)	625
BmsI	GCATC	3 cut(s)	405, 872, 1130
BmuI	ACTGGG	1 cut(s)	625
BpiI	GAAGAC	1 cut(s)	559
BpuEI	CTTGAG	1 cut(s)	212
Bsa29I	ATCGAT	1 cut(s)	938
BsaAI	YACGTR	1 cut(s)	540
BsaJI	CCNNGG	2 cut(s)	557, 867
BsaWI	WCCGGW	1 cut(s)	814
Bsc4I	CCNNNNNNNGG	3 cut(s)	558, 842, 843
Bse1I	ACTGG	2 cut(s)	425, 631
Bse3DI	GCAATG	1 cut(s)	1163
BseCI	ATCGAT	1 cut(s)	938
BseDI	CCNNGG	2 cut(s)	557, 867
BseGI	GGATG	3 cut(s)	613, 823, 863
BseLI	CCNNNNNNNGG	3 cut(s)	558, 842, 843
BseMI	GCAATG	1 cut(s)	1163
BseMII	CTCAG	1 cut(s)	632
BseNI	ACTGG	2 cut(s)	425, 631
BseXI	GCAGC	1 cut(s)	909
Bsh1236I	CGCG	1 cut(s)	383
Bsh1285I	CGRYCG	1 cut(s)	1177
BshFI	GGCC	1 cut(s)	982
BshVI	ATCGAT	1 cut(s)	938
BsiEI	CGRYCG	1 cut(s)	1177
BsiHKAI	GWGCWC	1 cut(s)	237
BsiSI	CCGG	1 cut(s)	815
BslFI	GGGAC	1 cut(s)	1257
BslI	CCNNNNNNNGG	3 cut(s)	558, 842, 843
BsmAI	GTCTC	1 cut(s)	887
BsmFI	GGGAC	1 cut(s)	1257
BsmI	GAATGC	3 cut(s)	284, 416, 1190
BsnI	GGCC	1 cut(s)	982
Bsp1286I	GDGCHC	1 cut(s)	237
Bsp143I	GATC	3 cut(s)	329, 786, 1174
BspACI	CCGC	2 cut(s)	394, 918
BspANI	GGCC	1 cut(s)	982
BspCNI	CTCAG	1 cut(s)	631
BspDI	ATCGAT	1 cut(s)	938
BspFNI	CGCG	1 cut(s)	383
BspLI	GGNNCC	2 cut(s)	26, 1245
BspMAI	CTGCAG	1 cut(s)	927
BspPI	GGATC	1 cut(s)	324
BsrDI	GCAATG	1 cut(s)	1163
BsrI	ACTGG	2 cut(s)	425, 631
BssECI	CCNNGG	2 cut(s)	557, 867
BssMI	GATC	3 cut(s)	329, 786, 1174
BssT1I	CCWWGG	2 cut(s)	557, 867
Bst4CI	ACNGT	1 cut(s)	931
BstBAI	YACGTR	1 cut(s)	540
BstC8I	GCNNGC	1 cut(s)	920
BstDEI	CTNAG	3 cut(s)	56, 404, 618
BstF5I	GGATG	3 cut(s)	613, 823, 863
BstFNI	CGCG	1 cut(s)	383
BstHHI	GCGC	1 cut(s)	383
BstKTI	GATC	3 cut(s)	332, 789, 1177
BstMAI	GTCTC	1 cut(s)	887
BstMBI	GATC	3 cut(s)	329, 786, 1174
BstMCI	CGRYCG	1 cut(s)	1177
BstNSI	RCATGY	1 cut(s)	666
BstSFI	CTRYAG	1 cut(s)	923
BstUI	CGCG	1 cut(s)	383
BstV1I	GCAGC	1 cut(s)	909
BstV2I	GAAGAC	1 cut(s)	559
Bsu15I	ATCGAT	1 cut(s)	938
BsuRI	GGCC	1 cut(s)	982
BsuTUI	ATCGAT	1 cut(s)	938
BtsCI	GGATG	3 cut(s)	613, 823, 863
BtsIMutI	CAGTG	1 cut(s)	638
Cac8I	GCNNGC	1 cut(s)	920
CfoI	GCGC	1 cut(s)	383
Cfr13I	GGNCC	2 cut(s)	651, 1244
ClaI	ATCGAT	1 cut(s)	938
Csp6I	GTAC	3 cut(s)	436, 704, 855
CviAII	CATG	4 cut(s)	663, 694, 848, 1150
CviJI	RGCY	6 cut(s)	104, 518, 556, 578, 922, 982
CviKI_1	RGCY	6 cut(s)	104, 518, 556, 578, 922, 982
CviQI	GTAC	3 cut(s)	436, 704, 855
DdeI	CTNAG	3 cut(s)	56, 404, 618
DpnI	GATC	3 cut(s)	331, 788, 1176
DpnII	GATC	3 cut(s)	329, 786, 1174
DraI	TTTAAA	1 cut(s)	270
Eco130I	CCWWGG	2 cut(s)	557, 867
Eco32I	GATATC	1 cut(s)	604
Eco47I	GGWCC	2 cut(s)	651, 1244
Eco72I	CACGTG	1 cut(s)	540
EcoO109I	RGGNCCY	1 cut(s)	651
EcoRV	GATATC	1 cut(s)	604
EcoT14I	CCWWGG	2 cut(s)	557, 867
EcoT22I	ATGCAT	1 cut(s)	418
ErhI	CCWWGG	2 cut(s)	557, 867
FaeI	CATG	4 cut(s)	666, 697, 851, 1153
FaqI	GGGAC	1 cut(s)	1257
FatI	CATG	4 cut(s)	662, 693, 847, 1149
FauI	CCCGC	2 cut(s)	401, 911
FblI	GTMKAC	1 cut(s)	986
Fnu4HI	GCNGC	1 cut(s)	923
FokI	GGATG	3 cut(s)	600, 830, 850
Fsp4HI	GCNGC	1 cut(s)	923
FspBI	CTAG	2 cut(s)	101, 297
GlaI	GCGC	1 cut(s)	382
GluI	GCNGC	1 cut(s)	923
HaeIII	GGCC	1 cut(s)	982
HapII	CCGG	1 cut(s)	815
HhaI	GCGC	1 cut(s)	383
Hin1II	CATG	4 cut(s)	666, 697, 851, 1153
Hin6I	GCGC	1 cut(s)	381
HinP1I	GCGC	1 cut(s)	381
HinfI	GANTC	5 cut(s)	95, 187, 194, 293, 1160
HpaII	CCGG	1 cut(s)	815
HphI	GGTGA	1 cut(s)	98
Hpy166II	GTNNAC	3 cut(s)	638, 706, 987
Hpy188I	TCNGA	4 cut(s)	601, 621, 1128, 1174
Hpy188III	TCNNGA	4 cut(s)	16, 191, 571, 1178
Hpy8I	GTNNAC	3 cut(s)	638, 706, 987
HpyAV	CCTTC	2 cut(s)	568, 664
HpyCH4III	ACNGT	1 cut(s)	931
HpyCH4IV	ACGT	2 cut(s)	539, 989
HpyF3I	CTNAG	3 cut(s)	56, 404, 618
HpySE526I	ACGT	2 cut(s)	539, 989
Hsp92II	CATG	4 cut(s)	666, 697, 851, 1153
HspAI	GCGC	1 cut(s)	381
Kzo9I	GATC	3 cut(s)	329, 786, 1174
LpnPI	CCDG	5 cut(s)	260, 438, 644, 759, 828
Lsp1109I	GCAGC	1 cut(s)	909
LweI	GCATC	3 cut(s)	405, 872, 1130
MaeI	CTAG	2 cut(s)	101, 297
MaeII	ACGT	2 cut(s)	539, 989
MaeIII	GTNAC	4 cut(s)	223, 739, 990, 1178
MalI	GATC	3 cut(s)	331, 788, 1176
MboI	GATC	3 cut(s)	329, 786, 1174
MboII	GAAGA	2 cut(s)	559, 998
MfeI	CAATTG	1 cut(s)	353
MhlI	GDGCHC	1 cut(s)	237
MlyI	GAGTC	3 cut(s)	196, 203, 302
MnlI	CCTC	5 cut(s)	359, 627, 791, 835, 1150
Mph1103I	ATGCAT	1 cut(s)	418
MseI	TTAA	7 cut(s)	183, 260, 269, 372, 962, 1068, 1257
MspI	CCGG	1 cut(s)	815
MunI	CAATTG	1 cut(s)	353
Mva1269I	GAATGC	3 cut(s)	284, 416, 1190
MvnI	CGCG	1 cut(s)	383
NdeII	GATC	3 cut(s)	329, 786, 1174
NlaIII	CATG	4 cut(s)	666, 697, 851, 1153
NlaIV	GGNNCC	2 cut(s)	26, 1245
NmuCI	GTSAC	1 cut(s)	1178
NsiI	ATGCAT	1 cut(s)	418
NspI	RCATGY	1 cut(s)	666
PctI	GAATGC	3 cut(s)	284, 416, 1190
PfeI	GAWTC	2 cut(s)	95, 1160
PflMI	CCANNNNNTGG	1 cut(s)	558
PkrI	GCNGC	1 cut(s)	924
Ple19I	CGATCG	1 cut(s)	1177
PleI	GAGTC	3 cut(s)	195, 202, 301
PmaCI	CACGTG	1 cut(s)	540
PmlI	CACGTG	1 cut(s)	540
PpsI	GAGTC	3 cut(s)	195, 202, 301
Ppu21I	YACGTR	1 cut(s)	540
PpuMI	RGGWCCY	1 cut(s)	651
PsiI	TTATAA	1 cut(s)	1143
Psp5II	RGGWCCY	1 cut(s)	651
PspCI	CACGTG	1 cut(s)	540
PspN4I	GGNNCC	2 cut(s)	26, 1245
PspPI	GGNCC	2 cut(s)	651, 1244
PspPPI	RGGWCCY	1 cut(s)	651
PstI	CTGCAG	1 cut(s)	927
PvuI	CGATCG	1 cut(s)	1177
RsaI	GTAC	3 cut(s)	437, 705, 856
RsaNI	GTAC	3 cut(s)	436, 704, 855
SaqAI	TTAA	7 cut(s)	183, 260, 269, 372, 962, 1068, 1257
SatI	GCNGC	1 cut(s)	923
Sau3AI	GATC	3 cut(s)	329, 786, 1174
Sau96I	GGNCC	2 cut(s)	651, 1244
SchI	GAGTC	3 cut(s)	196, 203, 302
SduI	GDGCHC	1 cut(s)	237
SetI	ASST	9 cut(s)	106, 346, 520, 542, 656, 778, 802, 829, 992
SfaNI	GCATC	3 cut(s)	405, 872, 1130
SfcI	CTRYAG	1 cut(s)	923
SinI	GGWCC	2 cut(s)	651, 1244
SmlI	CTYRAG	1 cut(s)	191
SmoI	CTYRAG	1 cut(s)	191
SsiI	CCGC	2 cut(s)	394, 918
SspMI	CTAG	2 cut(s)	101, 297
StyI	CCWWGG	2 cut(s)	557, 867
TaaI	ACNGT	1 cut(s)	931
TaiI	ACGT	2 cut(s)	542, 992
TaqI	TCGA	3 cut(s)	93, 789, 938
TatI	WGTACW	2 cut(s)	435, 703
TfiI	GAWTC	2 cut(s)	95, 1160
Tru1I	TTAA	7 cut(s)	183, 260, 269, 372, 962, 1068, 1257
Tru9I	TTAA	7 cut(s)	183, 260, 269, 372, 962, 1068, 1257
TscAI	CASTG	1 cut(s)	638
TseFI	GTSAC	1 cut(s)	1178
TseI	GCWGC	1 cut(s)	922
Tsp45I	GTSAC	1 cut(s)	1178
TspDTI	ATGAA	7 cut(s)	121, 299, 516, 602, 939, 998, 1166
TspRI	CASTG	1 cut(s)	638
Van91I	CCANNNNNTGG	1 cut(s)	558
VpaK11BI	GGWCC	2 cut(s)	651, 1244
XapI	RAATTY	3 cut(s)	873, 1235, 1249
XceI	RCATGY	1 cut(s)	666
XmiI	GTMKAC	1 cut(s)	986
XspI	CTAG	2 cut(s)	101, 297
Zsp2I	ATGCAT	1 cut(s)	418

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.