Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr1

Orthogroup ID

OG0000608

Physical Location & Seq

Genomic Coordinates Forward (+)

586328 .. 587969

Gene Structure 1642 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom01g00530.11

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1086 bp

ATGGAGATGAACCCCTTAGCTAGGTTCCCATCCATTCTATTCTATCACACATTCACATTTACATTTTGCTTTAATTTGAATTTGTTAGAAAGTGTCTTAGTTTGTGTTTATAAGTGTTTTGATTCATTTTGTTACATAAATTCGTCCAAATTCACCAAAGTGCTCAAAACTGCCCAGAAAGTGATTTTAAGGCATGTTTTATATTGTGTTTATGAGTGTTTTGATTCATTTTATTTCCCAATTTCGTCCAAATTCACCAAAGTGCTCAAAACTGCCCAGAAAGTGATTTTAAGGCATTTTGCATTCTTTGAGTCTAGTATAGTGTTTCATATTGTTATTTTACCCCCGGTCCAGAACGATCCCTACTTATACATATACTACAATGCGACGAAAAGAGGGTTAATTTGTGCGCGTATAAATCTCGCATCAAGGGTCCTTCTCCACACATGGCACACTTGCATACAAATTGATTTCCAGTTTAACCCTCAGATTTTCCTTAAGTCATTGAATTGGATGGAATACGCATCGAGATACAATCAAAGATCATTAAGCTTTGTGAAAATCATAAACATTGACAAGGCATTCATAACTATGAACAGCATGATACTCCTGCCAAGAATTTACTTAATACGATTTTCAGCATCAAATTCAAGCATGCAAACTAAGCGGTTAAGTAAATTGTATTCACGATTTATGAAATCACAACTGAAAGTAATCAATTCATATTGCAAATTTAATCATGGTTTCAAAGTCTCCTCTATAAACTTCAACATTAAAAACAAAGATAGAATACACCTAGAAACACTCCAGGTGGCTCCTCCTTCCTTCCTTGCTGCGCACAATGGGGATTTGTGTGAATTTAGGCTCTTGAGGTGTGGTGGATGGTGTGGTGTGAAATTGTGGGAAGGCACGAAATTTGGGCTGAAAATGAGAGGAATTAGGACTCTAAATCACCAAAGAACAAGGACACTTTCAATCAGATTCCATGGAGGACAAGGAATGGTCCTTGTGGCAGATTCTAGAACTTCTAGAAGGGTTACATGTAGCATAAACCTAGGGCACGAAAATAGGGCTTCTAGAACATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

362

Amino Acids

42.19

Weight (kDa)

9.98

Isoelectric Point (pI)

38.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000608)

Species	Orthologous Gene IDs
malus_domestica	MD01G1168300.v1.1 MD07G1127200.v1.1
prunus_persica	Prupe.5G065800_v2.0.a1
pyrus_communis	pycom01g00450 pycom01g00530 pycom01g00860 pycom01g01270 pycom01g01320 pycom01g01350 pycom01g01370 pycom01g01420 pycom01g01440 pycom01g01750 pycom01g02240 pycom01g02250 pycom01g02980 pycom01g03610 pycom01g04360 pycom03g18640 pycom05g08190 pycom05g08210 pycom05g08250 pycom05g08270 pycom05g22500 pycom11g13900 pycom12424g00150 pycom12426g00120 pycom12426g00140 pycom12426g00190 pycom12426g00200 pycom12426g00480 pycom1256g00170 pycom1256g00250 pycom12659g00080 pycom12659g00170 pycom12659g00200 pycom12661g00070 pycom12661g00120 pycom12g04960 pycom1341g00040 pycom13g23150 pycom13g23290 pycom13g24030 pycom13g24710 pycom13g25450 pycom13g25530 pycom13g25630 pycom13g25650 pycom13g25850 pycom13g25920 pycom13g26130 pycom13g26150 pycom13g26180 pycom13g26190 pycom13g26310 pycom13g27290 pycom13g28010 pycom13g28180 pycom1654g00090 pycom1654g00100 pycom17g16670 pycom17g16980 pycom17g17190 pycom17g17210 pycom17g17290 pycom17g17520 pycom17g17750 pycom17g17770 pycom17g17820 pycom17g18030 pycom17g18060 pycom17g18070 pycom17g18240 pycom280g00030 pycom436g00360 pycom520g00110 pycom520g01100 pycom808g00240 pycom808g00490 pycom808g00610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	111
Acc16I	TGCGCA	1 cut(s)	837
AccII	CGCG	1 cut(s)	412
AciI	CCGC	1 cut(s)	667
AclWI	GGATC	1 cut(s)	353
AcsI	RAATTY	9 cut(s)	79, 139, 149, 251, 618, 646, 731, 857, 914
AfiI	CCNNNNNNNGG	1 cut(s)	21
AflII	CTTAAG	1 cut(s)	497
AflIII	ACRYGT	1 cut(s)	1040
AgsI	TTSAA	6 cut(s)	79, 508, 651, 748, 769, 975
AjnI	CCWGG	1 cut(s)	807
AleI	CACNNNNGTG	2 cut(s)	158, 260
AluBI	AGCT	2 cut(s)	20, 552
AluI	AGCT	2 cut(s)	20, 552
Alw21I	GWGCWC	2 cut(s)	165, 267
Alw26I	GTCTC	1 cut(s)	757
AlwI	GGATC	1 cut(s)	353
ApeKI	GCWGC	1 cut(s)	833
ApoI	RAATTY	9 cut(s)	79, 139, 149, 251, 618, 646, 731, 857, 914
AspA2I	CCTAGG	1 cut(s)	1054
AspLEI	GCGC	2 cut(s)	412, 838
AspS9I	GGNCC	3 cut(s)	349, 433, 1003
AsuC2I	CCSGG	1 cut(s)	347
AsuHPI	GGTGA	3 cut(s)	145, 247, 944
AvaII	GGWCC	3 cut(s)	349, 433, 1003
AvrII	CCTAGG	1 cut(s)	1054
BaeGI	GKGCMC	1 cut(s)	1062
Bbv12I	GWGCWC	2 cut(s)	165, 267
BbvI	GCAGC	1 cut(s)	820
BccI	CCATC	3 cut(s)	37, 508, 876
BciT130I	CCWGG	1 cut(s)	809
BcnI	CCSGG	1 cut(s)	347
BcoDI	GTCTC	1 cut(s)	757
BfaI	CTAG	7 cut(s)	21, 315, 797, 1020, 1029, 1055, 1077
BfrI	CTTAAG	1 cut(s)	497
BisI	GCNGC	1 cut(s)	834
BlnI	CCTAGG	1 cut(s)	1054
BlsI	GCNGC	1 cut(s)	835
Bme1390I	CCNGG	2 cut(s)	347, 809
Bme18I	GGWCC	3 cut(s)	349, 433, 1003
BmgT120I	GGNCC	3 cut(s)	349, 433, 1003
BmiI	GGNNCC	3 cut(s)	26, 434, 816
BmrFI	CCNGG	2 cut(s)	347, 809
BmsI	GCATC	3 cut(s)	434, 533, 650
BpmI	CTGGAG	1 cut(s)	791
Bpu10I	CCTNAGC	1 cut(s)	16
BpuEI	CTTGAG	1 cut(s)	889
BpuMI	CCSGG	1 cut(s)	347
BsaJI	CCNNGG	3 cut(s)	345, 985, 1054
Bsc4I	CCNNNNNNNGG	1 cut(s)	21
Bse1I	ACTGG	1 cut(s)	475
BseBI	CCWGG	1 cut(s)	809
BseDI	CCNNGG	3 cut(s)	345, 985, 1054
BseGI	GGATG	3 cut(s)	29, 519, 887
BseLI	CCNNNNNNNGG	1 cut(s)	21
BseMII	CTCAG	1 cut(s)	500
BseNI	ACTGG	1 cut(s)	475
BseRI	GAGGAG	2 cut(s)	745, 807
BseSI	GKGCMC	1 cut(s)	1062
BseXI	GCAGC	1 cut(s)	820
Bsh1236I	CGCG	1 cut(s)	412
BsiHKAI	GWGCWC	2 cut(s)	165, 267
BsiSI	CCGG	1 cut(s)	347
BslI	CCNNNNNNNGG	1 cut(s)	21
BsmAI	GTCTC	1 cut(s)	757
BsmI	GAATGC	2 cut(s)	302, 581
Bsp1286I	GDGCHC	3 cut(s)	165, 267, 1062
Bsp143I	GATC	2 cut(s)	358, 542
Bsp19I	CCATGG	1 cut(s)	985
BspACI	CCGC	1 cut(s)	667
BspCNI	CTCAG	1 cut(s)	499
BspFNI	CGCG	1 cut(s)	412
BspLI	GGNNCC	3 cut(s)	26, 434, 816
BspPI	GGATC	1 cut(s)	353
BspTI	CTTAAG	1 cut(s)	497
BsrI	ACTGG	1 cut(s)	475
BssECI	CCNNGG	3 cut(s)	345, 985, 1054
BssMI	GATC	2 cut(s)	358, 542
BssT1I	CCWWGG	2 cut(s)	985, 1054
Bst2UI	CCWGG	1 cut(s)	809
BstAFI	CTTAAG	1 cut(s)	497
BstC8I	GCNNGC	1 cut(s)	656
BstDEI	CTNAG	4 cut(s)	16, 97, 486, 663
BstDSI	CCRYGG	1 cut(s)	985
BstENI	CCTNNNNNAGG	1 cut(s)	19
BstF5I	GGATG	3 cut(s)	29, 519, 887
BstFNI	CGCG	1 cut(s)	412
BstHHI	GCGC	2 cut(s)	412, 838
BstKTI	GATC	2 cut(s)	361, 545
BstMAI	GTCTC	1 cut(s)	757
BstMBI	GATC	2 cut(s)	358, 542
BstMWI	GCNNNNNNNGC	1 cut(s)	664
BstNI	CCWGG	1 cut(s)	809
BstNSI	RCATGY	3 cut(s)	197, 658, 1044
BstSCI	CCNGG	2 cut(s)	345, 807
BstSLI	GKGCMC	1 cut(s)	1062
BstUI	CGCG	1 cut(s)	412
BstV1I	GCAGC	1 cut(s)	820
BtgI	CCRYGG	1 cut(s)	985
BtsCI	GGATG	3 cut(s)	29, 519, 887
Cac8I	GCNNGC	1 cut(s)	656
CfoI	GCGC	2 cut(s)	412, 838
Cfr13I	GGNCC	3 cut(s)	349, 433, 1003
CviAII	CATG	8 cut(s)	194, 447, 601, 655, 740, 986, 1041, 1083
CviJI	RGCY	6 cut(s)	20, 552, 815, 865, 922, 1073
CviKI_1	RGCY	6 cut(s)	20, 552, 815, 865, 922, 1073
DdeI	CTNAG	4 cut(s)	16, 97, 486, 663
DpnI	GATC	2 cut(s)	360, 544
DpnII	GATC	2 cut(s)	358, 542
Eco130I	CCWWGG	2 cut(s)	985, 1054
Eco47I	GGWCC	3 cut(s)	349, 433, 1003
EcoNI	CCTNNNNNAGG	1 cut(s)	19
EcoO109I	RGGNCCY	1 cut(s)	433
EcoRII	CCWGG	1 cut(s)	807
EcoT14I	CCWWGG	2 cut(s)	985, 1054
ErhI	CCWWGG	2 cut(s)	985, 1054
FaeI	CATG	8 cut(s)	197, 450, 604, 658, 743, 989, 1044, 1086
FatI	CATG	8 cut(s)	193, 446, 600, 654, 739, 985, 1040, 1082
Fnu4HI	GCNGC	1 cut(s)	834
FokI	GGATG	3 cut(s)	16, 526, 894
Fsp4HI	GCNGC	1 cut(s)	834
FspBI	CTAG	7 cut(s)	21, 315, 797, 1020, 1029, 1055, 1077
FspI	TGCGCA	1 cut(s)	837
GlaI	GCGC	2 cut(s)	411, 837
GluI	GCNGC	1 cut(s)	834
GsuI	CTGGAG	1 cut(s)	791
HapII	CCGG	1 cut(s)	347
HhaI	GCGC	2 cut(s)	412, 838
Hin1II	CATG	8 cut(s)	197, 450, 604, 658, 743, 989, 1044, 1086
Hin6I	GCGC	2 cut(s)	410, 836
HinP1I	GCGC	2 cut(s)	410, 836
HindIII	AAGCTT	1 cut(s)	550
HinfI	GANTC	6 cut(s)	122, 224, 311, 943, 981, 1016
HpaII	CCGG	1 cut(s)	347
HphI	GGTGA	3 cut(s)	145, 247, 944
Hpy188I	TCNGA	2 cut(s)	489, 980
Hpy188III	TCNNGA	7 cut(s)	352, 528, 687, 868, 1020, 1029, 1077
Hpy99I	CGWCG	1 cut(s)	391
HpyAV	CCTTC	5 cut(s)	446, 831, 835, 899, 1026
HpyCH4V	TGCA	4 cut(s)	302, 459, 658, 729
HpyF10VI	GCNNNNNNNGC	1 cut(s)	664
HpyF3I	CTNAG	4 cut(s)	16, 97, 486, 663
Hsp92II	CATG	8 cut(s)	197, 450, 604, 658, 743, 989, 1044, 1086
HspAI	GCGC	2 cut(s)	410, 836
Kzo9I	GATC	2 cut(s)	358, 542
LmnI	GCTCC	1 cut(s)	820
LpnPI	CCDG	8 cut(s)	188, 290, 360, 365, 488, 623, 794, 821
Lsp1109I	GCAGC	1 cut(s)	820
LweI	GCATC	3 cut(s)	434, 533, 650
MaeI	CTAG	7 cut(s)	21, 315, 797, 1020, 1029, 1055, 1077
MaeIII	GTNAC	2 cut(s)	131, 1036
MalI	GATC	2 cut(s)	360, 544
MboI	GATC	2 cut(s)	358, 542
MhlI	GDGCHC	3 cut(s)	165, 267, 1062
MlyI	GAGTC	2 cut(s)	320, 937
MnlI	CCTC	7 cut(s)	389, 495, 766, 828, 864, 926, 983
MslI	CAYNNNNRTG	3 cut(s)	158, 260, 590
MspCI	CTTAAG	1 cut(s)	497
MspI	CCGG	1 cut(s)	347
MspR9I	CCNGG	2 cut(s)	347, 809
Mva1269I	GAATGC	2 cut(s)	302, 581
MvaI	CCWGG	1 cut(s)	809
MvnI	CGCG	1 cut(s)	412
MwoI	GCNNNNNNNGC	1 cut(s)	664
NciI	CCSGG	1 cut(s)	347
NcoI	CCATGG	1 cut(s)	985
NdeII	GATC	2 cut(s)	358, 542
NlaIII	CATG	8 cut(s)	197, 450, 604, 658, 743, 989, 1044, 1086
NlaIV	GGNNCC	3 cut(s)	26, 434, 816
NsbI	TGCGCA	1 cut(s)	837
NspI	RCATGY	3 cut(s)	197, 658, 1044
OliI	CACNNNNGTG	2 cut(s)	158, 260
PaeI	GCATGC	1 cut(s)	658
PciI	ACATGT	1 cut(s)	1040
PctI	GAATGC	2 cut(s)	302, 581
PfeI	GAWTC	4 cut(s)	122, 224, 981, 1016
PkrI	GCNGC	1 cut(s)	835
PleI	GAGTC	2 cut(s)	319, 937
PpsI	GAGTC	2 cut(s)	319, 937
PpuMI	RGGWCCY	1 cut(s)	433
PscI	ACATGT	1 cut(s)	1040
PsiI	TTATAA	1 cut(s)	111
Psp5II	RGGWCCY	1 cut(s)	433
Psp6I	CCWGG	1 cut(s)	807
PspGI	CCWGG	1 cut(s)	807
PspN4I	GGNNCC	3 cut(s)	26, 434, 816
PspPI	GGNCC	3 cut(s)	349, 433, 1003
PspPPI	RGGWCCY	1 cut(s)	433
PsrI	GAACNNNNNNTAC	2 cut(s)	347, 379
RseI	CAYNNNNRTG	3 cut(s)	158, 260, 590
SatI	GCNGC	1 cut(s)	834
Sau3AI	GATC	2 cut(s)	358, 542
Sau96I	GGNCC	3 cut(s)	349, 433, 1003
SchI	GAGTC	2 cut(s)	320, 937
ScrFI	CCNGG	2 cut(s)	347, 809
SduI	GDGCHC	3 cut(s)	165, 267, 1062
SetI	ASST	7 cut(s)	22, 26, 554, 798, 813, 875, 1056
SfaNI	GCATC	3 cut(s)	434, 533, 650
SinI	GGWCC	3 cut(s)	349, 433, 1003
SmiMI	CAYNNNNRTG	3 cut(s)	158, 260, 590
SmlI	CTYRAG	2 cut(s)	497, 868
SmoI	CTYRAG	2 cut(s)	497, 868
SphI	GCATGC	1 cut(s)	658
SsiI	CCGC	1 cut(s)	667
SspMI	CTAG	7 cut(s)	21, 315, 797, 1020, 1029, 1055, 1077
StyD4I	CCNGG	2 cut(s)	345, 807
StyI	CCWWGG	2 cut(s)	985, 1054
TaqI	TCGA	1 cut(s)	527
TfiI	GAWTC	4 cut(s)	122, 224, 981, 1016
TseI	GCWGC	1 cut(s)	833
TspDTI	ATGAA	8 cut(s)	23, 114, 216, 317, 574, 608, 710, 711
Vha464I	CTTAAG	1 cut(s)	497
VpaK11BI	GGWCC	3 cut(s)	349, 433, 1003
XagI	CCTNNNNNAGG	1 cut(s)	19
XapI	RAATTY	9 cut(s)	79, 139, 149, 251, 618, 646, 731, 857, 914
XbaI	TCTAGA	3 cut(s)	1019, 1028, 1076
XceI	RCATGY	3 cut(s)	197, 658, 1044
XmaJI	CCTAGG	1 cut(s)	1054
XspI	CTAG	7 cut(s)	21, 315, 797, 1020, 1029, 1055, 1077

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.