pycom13g23150

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000608
Physical Location & Seq
Forward (+)
20828201 .. 20828654
454 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g23150.2

Sequence Viewer

Length: 291 bp
ATGAAAGGATGGCTAAAGGATTCTTCTCTACACCTGAATCATATAGTACTAATTAACTCTCAGATTTTCCTAAGTTCATTGAATTGGACTTGGCGACGCAACCAAATTATTCTTCTCAAGTTCCCTGACTATGAAAAGCATGACAAAGATACATCTCAAAGATCATTAAGTTCTGTGAAAATCATAAGCATTGACAAAGCATTCATAACTATGAAAATGACTTTTACTACTTGCAAATATAAGTTCATAACGATTAGTGTAACTAAGTGTGCACCCTTAATAAACATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.25

Weight (kDa)

9.83

Isoelectric Point (pI)

40.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 48
AgsI TTSAA 1 cut(s) 82
AjuI GAANNNNNNNTTGG 2 cut(s) 96, 128
Alw21I GWGCWC 1 cut(s) 274
Alw44I GTGCAC 1 cut(s) 270
ApaLI GTGCAC 1 cut(s) 270
BaeGI GKGCMC 1 cut(s) 274
Bbv12I GWGCWC 1 cut(s) 274
BccI CCATC 1 cut(s) 3
BmcAI AGTACT 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 101
BseGI GGATG 1 cut(s) 14
BseMII CTCAG 1 cut(s) 74
BseSI GKGCMC 1 cut(s) 274
BsiHKAI GWGCWC 1 cut(s) 274
BsmI GAATGC 1 cut(s) 200
Bsp1286I GDGCHC 1 cut(s) 274
Bsp143I GATC 1 cut(s) 161
BspCNI CTCAG 1 cut(s) 73
BssMI GATC 1 cut(s) 161
BstDEI CTNAG 3 cut(s) 60, 71, 264
BstF5I GGATG 1 cut(s) 14
BstKTI GATC 1 cut(s) 164
BstMBI GATC 1 cut(s) 161
BstSLI GKGCMC 1 cut(s) 274
BtsCI GGATG 1 cut(s) 14
CseI GACGC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 47
CviAII CATG 1 cut(s) 140
CviJI RGCY 1 cut(s) 13
CviKI_1 RGCY 1 cut(s) 13
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 3 cut(s) 60, 71, 264
DpnI GATC 1 cut(s) 163
DpnII GATC 1 cut(s) 161
FaeI CATG 1 cut(s) 143
FatI CATG 1 cut(s) 139
FokI GGATG 1 cut(s) 21
FspEI CC 8 cut(s) 2, 47, 70, 76, 83, 116, 137, 138
HgaI GACGC 1 cut(s) 105
Hin1II CATG 1 cut(s) 143
HinfI GANTC 2 cut(s) 20, 37
Hpy166II GTNNAC 1 cut(s) 272
Hpy188I TCNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 272
Hpy99I CGWCG 1 cut(s) 99
HpyCH4V TGCA 2 cut(s) 234, 272
HpyF3I CTNAG 3 cut(s) 60, 71, 264
Hsp92II CATG 1 cut(s) 143
Kzo9I GATC 1 cut(s) 161
LpnPI CCDG 2 cut(s) 47, 138
MaeIII GTNAC 1 cut(s) 259
MalI GATC 1 cut(s) 163
MboI GATC 1 cut(s) 161
MboII GAAGA 2 cut(s) 15, 104
MhlI GDGCHC 1 cut(s) 274
MluCI AATT 3 cut(s) 51, 82, 105
MseI TTAA 3 cut(s) 54, 167, 278
MslI CAYNNNNRTG 1 cut(s) 209
Mva1269I GAATGC 1 cut(s) 200
NdeII GATC 1 cut(s) 161
NlaIII CATG 1 cut(s) 143
PctI GAATGC 1 cut(s) 200
PfeI GAWTC 2 cut(s) 20, 37
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
RseI CAYNNNNRTG 1 cut(s) 209
SaqAI TTAA 3 cut(s) 54, 167, 278
Sau3AI GATC 1 cut(s) 161
ScaI AGTACT 1 cut(s) 48
SduI GDGCHC 1 cut(s) 274
SetI ASST 1 cut(s) 36
SgeI CNNG 6 cut(s) 46, 102, 130, 137, 152, 243
SmiMI CAYNNNNRTG 1 cut(s) 209
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 3 cut(s) 51, 82, 105
TasI AATT 3 cut(s) 51, 82, 105
TatI WGTACW 1 cut(s) 46
TfiI GAWTC 2 cut(s) 20, 37
Tru1I TTAA 3 cut(s) 54, 167, 278
Tru9I TTAA 3 cut(s) 54, 167, 278
TspDTI ATGAA 6 cut(s) 17, 66, 147, 193, 227, 235
VneI GTGCAC 1 cut(s) 270
ZrmI AGTACT 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.