pycom1256g00250

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001256
OG0000608
Physical Location & Seq
Forward (+)
198585 .. 198869
285 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1256g00250.2

Sequence Viewer

Length: 201 bp
ATGCATACGAACCAATTTCCATTGCATCGCACAACTAACCATCAGATTTTCCTATCTTTCTCAAGTTCCCTATATGAAACGCATGATAGAGATACATGTCAAAAGTCATTAAGTTCTATGAAAATCGTAAGCATTGACAAGGCATTCATTACTATGAAACGCATGAGACTCATACCAAGGATTTACTTAACACGATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.89

Weight (kDa)

10.28

Isoelectric Point (pI)

14.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 95
AleI CACNNNNGTG 1 cut(s) 196
Alw26I GTCTC 1 cut(s) 160
BccI CCATC 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 160
BmsI GCATC 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 176
Bse3DI GCAATG 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 176
BseMI GCAATG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 160
BsmI GAATGC 1 cut(s) 143
BsrDI GCAATG 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 176
BssT1I CCWWGG 1 cut(s) 176
BstMAI GTCTC 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 99
BtgZI GCGATG 1 cut(s) 11
CviAII CATG 3 cut(s) 83, 96, 163
Eco130I CCWWGG 1 cut(s) 176
EcoT14I CCWWGG 1 cut(s) 176
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 176
FaeI CATG 3 cut(s) 86, 99, 166
FaiI YATR 9 cut(s) 6, 73, 75, 84, 97, 119, 155, 164, 173
FatI CATG 3 cut(s) 82, 95, 162
FspEI CC 9 cut(s) 26, 33, 53, 65, 82, 83, 125, 163, 189
Hin1II CATG 3 cut(s) 86, 99, 166
HinfI GANTC 1 cut(s) 168
Hpy188I TCNGA 1 cut(s) 45
HpyCH4V TGCA 2 cut(s) 4, 25
Hsp92II CATG 3 cut(s) 86, 99, 166
LweI GCATC 1 cut(s) 34
MluCI AATT 1 cut(s) 14
MlyI GAGTC 1 cut(s) 162
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 110, 188
MslI CAYNNNNRTG 2 cut(s) 152, 196
Mva1269I GAATGC 1 cut(s) 143
NlaIII CATG 3 cut(s) 86, 99, 166
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 99
OliI CACNNNNGTG 1 cut(s) 196
PciI ACATGT 1 cut(s) 95
PctI GAATGC 1 cut(s) 143
PleI GAGTC 1 cut(s) 162
PpsI GAGTC 1 cut(s) 162
PscI ACATGT 1 cut(s) 95
RseI CAYNNNNRTG 2 cut(s) 152, 196
SaqAI TTAA 2 cut(s) 110, 188
SchI GAGTC 1 cut(s) 162
SfaNI GCATC 1 cut(s) 34
SgeI CNNG 6 cut(s) 75, 95, 108, 151, 175, 189
SmiMI CAYNNNNRTG 2 cut(s) 152, 196
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 1 cut(s) 14
StyI CCWWGG 1 cut(s) 176
TasI AATT 1 cut(s) 14
Tru1I TTAA 2 cut(s) 110, 188
Tru9I TTAA 2 cut(s) 110, 188
TspDTI ATGAA 4 cut(s) 90, 134, 136, 170
XceI RCATGY 1 cut(s) 99
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.