pycom808g00240

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000808
Physical Location & Seq
Forward (+)
133815 .. 134560
746 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom808g00240.1

Sequence Viewer

Length: 450 bp
ATGGGTGAAAGGCTAGTTAGAGGGTCCTTCTCCACACATGATATATTTGCATCACGCATTACAACCAAATTATCTTTCTCAAGTTCTTCATATGAAACGCATATTAAAGATACATATCAAAAGTCATTAAGTTTTGTGAAAACCATAAGCATTGACAAGGCATTCATCACTATGAAACTGAATAACTATTATGTGAAACCCCCTTATACTCTAGCATCAAATTCATGCATGCAAATTAAATGTCTACCCCCAACCCACATACAGAAACAAATAAAACATATAATCATGGCTTCGAATTCACCTCTAACTAAAAAGAAATTAGTTCCACATGATAGAATACACCTAGAAACACTCCACACTCCAATGGTAGATTTCGAACCCTCCTTGGATGGCAGATTGCACAAGTCTTCTTCTCCTTCCTTCCTTGCTTGCGACACTAGGGTGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

150

Amino Acids

16.93

Weight (kDa)

9.62

Isoelectric Point (pI)

44.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 244
AcsI RAATTY 2 cut(s) 220, 295
AjuI GAANNNNNNNTTGG 2 cut(s) 59, 91
AleI CACNNNNGTG 1 cut(s) 440
ApoI RAATTY 2 cut(s) 220, 295
ArsI GACNNNNNNTTYG 2 cut(s) 226, 258
AspS9I GGNCC 1 cut(s) 24
AsuHPI GGTGA 2 cut(s) 17, 291
AsuII TTCGAA 2 cut(s) 293, 375
AvaII GGWCC 1 cut(s) 24
BbsI GAAGAC 1 cut(s) 399
BccI CCATC 1 cut(s) 383
BfaI CTAG 4 cut(s) 14, 212, 344, 438
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmiI GGNNCC 1 cut(s) 25
BmsI GCATC 2 cut(s) 59, 224
BpiI GAAGAC 1 cut(s) 399
Bpu14I TTCGAA 2 cut(s) 293, 375
BpuEI CTTGAG 1 cut(s) 64
BsaBI GATNNNNATC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 384
Bse8I GATNNNNATC 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 384
BseGI GGATG 1 cut(s) 394
BseJI GATNNNNATC 1 cut(s) 114
BsmI GAATGC 1 cut(s) 161
Bsp119I TTCGAA 2 cut(s) 293, 375
BspLI GGNNCC 1 cut(s) 25
BspT104I TTCGAA 2 cut(s) 293, 375
BssECI CCNNGG 1 cut(s) 384
BssT1I CCWWGG 1 cut(s) 384
BstBI TTCGAA 2 cut(s) 293, 375
BstC8I GCNNGC 2 cut(s) 230, 430
BstF5I GGATG 1 cut(s) 394
BstNSI RCATGY 1 cut(s) 232
BstV2I GAAGAC 1 cut(s) 399
BtsCI GGATG 1 cut(s) 394
Cac8I GCNNGC 2 cut(s) 230, 430
Cfr13I GGNCC 1 cut(s) 24
CviAII CATG 5 cut(s) 38, 225, 229, 286, 329
CviJI RGCY 2 cut(s) 13, 290
CviKI_1 RGCY 2 cut(s) 13, 290
Eco130I CCWWGG 1 cut(s) 384
Eco47I GGWCC 1 cut(s) 24
EcoO109I RGGNCCY 1 cut(s) 24
EcoRI GAATTC 1 cut(s) 295
EcoT14I CCWWGG 1 cut(s) 384
EcoT22I ATGCAT 1 cut(s) 230
ErhI CCWWGG 1 cut(s) 384
FaeI CATG 5 cut(s) 41, 228, 232, 289, 332
FatI CATG 5 cut(s) 37, 224, 228, 285, 328
FauNDI CATATG 1 cut(s) 91
FblI GTMKAC 1 cut(s) 244
FokI GGATG 1 cut(s) 401
FspBI CTAG 4 cut(s) 14, 212, 344, 438
Hin1II CATG 5 cut(s) 41, 228, 232, 289, 332
HphI GGTGA 2 cut(s) 17, 291
Hpy166II GTNNAC 1 cut(s) 245
Hpy8I GTNNAC 1 cut(s) 245
HpyAV CCTTC 3 cut(s) 37, 426, 430
HpyCH4V TGCA 4 cut(s) 50, 228, 232, 400
Hsp92II CATG 5 cut(s) 41, 228, 232, 289, 332
LweI GCATC 2 cut(s) 59, 224
MaeI CTAG 4 cut(s) 14, 212, 344, 438
MboII GAAGA 3 cut(s) 78, 399, 402
MluCI AATT 5 cut(s) 68, 220, 234, 295, 317
MnlI CCTC 3 cut(s) 14, 312, 391
Mph1103I ATGCAT 1 cut(s) 230
MseI TTAA 3 cut(s) 105, 128, 237
MslI CAYNNNNRTG 3 cut(s) 170, 362, 440
Mva1269I GAATGC 1 cut(s) 161
NdeI CATATG 1 cut(s) 91
NlaIII CATG 5 cut(s) 41, 228, 232, 289, 332
NlaIV GGNNCC 1 cut(s) 25
NsiI ATGCAT 1 cut(s) 230
NspI RCATGY 1 cut(s) 232
NspV TTCGAA 2 cut(s) 293, 375
OliI CACNNNNGTG 1 cut(s) 440
PaeI GCATGC 1 cut(s) 232
PctI GAATGC 1 cut(s) 161
PpuMI RGGWCCY 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 25
PspPI GGNCC 1 cut(s) 24
PspPPI RGGWCCY 1 cut(s) 24
RseI CAYNNNNRTG 3 cut(s) 170, 362, 440
SaqAI TTAA 3 cut(s) 105, 128, 237
Sau96I GGNCC 1 cut(s) 24
SetI ASST 2 cut(s) 304, 345
SfaNI GCATC 2 cut(s) 59, 224
SfuI TTCGAA 2 cut(s) 293, 375
SinI GGWCC 1 cut(s) 24
SmiMI CAYNNNNRTG 3 cut(s) 170, 362, 440
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
SphI GCATGC 1 cut(s) 232
Sse9I AATT 5 cut(s) 68, 220, 234, 295, 317
SspMI CTAG 4 cut(s) 14, 212, 344, 438
StyI CCWWGG 1 cut(s) 384
TaqI TCGA 2 cut(s) 293, 375
TasI AATT 5 cut(s) 68, 220, 234, 295, 317
Tru1I TTAA 3 cut(s) 105, 128, 237
Tru9I TTAA 3 cut(s) 105, 128, 237
TspDTI ATGAA 5 cut(s) 78, 108, 154, 188, 213
VpaK11BI GGWCC 1 cut(s) 24
XapI RAATTY 2 cut(s) 220, 295
XceI RCATGY 1 cut(s) 232
XmiI GTMKAC 1 cut(s) 244
XspI CTAG 4 cut(s) 14, 212, 344, 438
Zsp2I ATGCAT 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.