pycom13g26130

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22857502 .. 22857909
408 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g26130.3

Sequence Viewer

Length: 300 bp
ATGATTGGGGGGATTTGGACGAATTTAATTAAAACGAAAGTAAAGTTCTTCTCCACACATGAATCATACGTATACAAATTGATTTTTACACTAATTAATTCTCAAATTTTCCTAAGTTCATTGAATTGGACTCAGCGACGCAACCAAATTATTCTTCTCAAGTTCATTAACTATGAAAAGCTTGATAGAGATGAATCTCAAAGATCATTAAGTTCTGTGAAAATCATAAGCATTGACAAGACATTTGTAACTATGAAAAACATGACACTCCTGCCAAGAATTTACTTAACTCAATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.75

Weight (kDa)

10.06

Isoelectric Point (pI)

24.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 72
AcsI RAATTY 3 cut(s) 22, 105, 279
AgsI TTSAA 1 cut(s) 124
AjuI GAANNNNNNNTTGG 2 cut(s) 138, 170
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
ApoI RAATTY 3 cut(s) 22, 105, 279
ArsI GACNNNNNNTTYG 2 cut(s) 227, 259
AseI ATTAAT 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 143
BsaAI YACGTR 1 cut(s) 70
BseMII CTCAG 1 cut(s) 146
Bsp143I GATC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 145
BspHI TCATGA 1 cut(s) 296
BssMI GATC 1 cut(s) 203
BssNAI GTATAC 1 cut(s) 73
Bst1107I GTATAC 1 cut(s) 73
BstBAI YACGTR 1 cut(s) 70
BstDEI CTNAG 2 cut(s) 113, 132
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstSNI TACGTA 1 cut(s) 70
BstZ17I GTATAC 1 cut(s) 73
CciI TCATGA 1 cut(s) 296
CseI GACGC 1 cut(s) 147
CviAII CATG 3 cut(s) 59, 262, 297
CviJI RGCY 1 cut(s) 181
CviKI_1 RGCY 1 cut(s) 181
DdeI CTNAG 2 cut(s) 113, 132
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
Eco105I TACGTA 1 cut(s) 70
FaeI CATG 3 cut(s) 62, 265, 300
FaiI YATR 8 cut(s) 60, 67, 73, 174, 227, 254, 263, 298
FatI CATG 3 cut(s) 58, 261, 296
FblI GTMKAC 1 cut(s) 72
FspEI CC 6 cut(s) 67, 112, 125, 158, 284, 288
HgaI GACGC 1 cut(s) 147
Hin1II CATG 3 cut(s) 62, 265, 300
HindIII AAGCTT 1 cut(s) 179
HinfI GANTC 3 cut(s) 62, 130, 194
Hpy166II GTNNAC 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 297
Hpy8I GTNNAC 1 cut(s) 73
Hpy99I CGWCG 1 cut(s) 141
HpyCH4IV ACGT 1 cut(s) 69
HpyF3I CTNAG 2 cut(s) 113, 132
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 3 cut(s) 62, 265, 300
Kzo9I GATC 1 cut(s) 203
LpnPI CCDG 1 cut(s) 284
MaeII ACGT 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 247
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MboII GAAGA 2 cut(s) 40, 146
MluCI AATT 9 cut(s) 22, 27, 77, 93, 97, 105, 124, 147, 279
MlyI GAGTC 1 cut(s) 124
MseI TTAA 6 cut(s) 26, 30, 96, 168, 209, 287
NdeII GATC 1 cut(s) 203
NlaIII CATG 3 cut(s) 62, 265, 300
PacI TTAATTAA 1 cut(s) 30
PagI TCATGA 1 cut(s) 296
PfeI GAWTC 2 cut(s) 62, 194
PleI GAGTC 1 cut(s) 124
PpsI GAGTC 1 cut(s) 124
Ppu21I YACGTR 1 cut(s) 70
PshBI ATTAAT 1 cut(s) 96
SaqAI TTAA 6 cut(s) 26, 30, 96, 168, 209, 287
Sau3AI GATC 1 cut(s) 203
SchI GAGTC 1 cut(s) 124
SetI ASST 2 cut(s) 72, 183
SgeI CNNG 7 cut(s) 71, 172, 194, 250, 274, 283, 288
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SnaBI TACGTA 1 cut(s) 70
Sse9I AATT 9 cut(s) 22, 27, 77, 93, 97, 105, 124, 147, 279
TaiI ACGT 1 cut(s) 72
TasI AATT 9 cut(s) 22, 27, 77, 93, 97, 105, 124, 147, 279
TfiI GAWTC 2 cut(s) 62, 194
Tru1I TTAA 6 cut(s) 26, 30, 96, 168, 209, 287
Tru9I TTAA 6 cut(s) 26, 30, 96, 168, 209, 287
TspDTI ATGAA 6 cut(s) 75, 108, 154, 189, 207, 269
VspI ATTAAT 1 cut(s) 96
XapI RAATTY 3 cut(s) 22, 105, 279
XmiI GTMKAC 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.