pycom12426g00710

AAA domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012426
Physical Location & Seq
Forward (+)
625508 .. 626095
588 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 588 bp
ATGACTCGTAGCTCTCGGCCTATTATAGAGAACATCTCCGACTTTGACGGTGATTTTGAACGCACTTTGAGGAGAACGAGGAGTCAACAAGAGCCACCACAACCTCCACCACAACCTGGGCTTGAAGAAGACGAAGTAGGTGTAGAAGAAAAGCCCACGGATCAGATTTTTGAAGAAGAACAAGCCATGGCAGCAGATAATAGAACCATCAAGGAGCTTTCGGCCTCGGGTCTGGATAATGCATTGCCTCTTTGTATCCAATACCCACGGCTGCCCAAGGCAAGACCGATGAATTTGAACTCAAATCCAGTTTGTTACACCATATTCCGAAGTTCCATGGCTTGTCTATGGAAGACCCCAACAACACTTGAAGGAGTTCGAGGTGGTTTGTTCGAGCATGACCCCCGTCAATGTGGATGGGAGTATATTGAAGATGAAGGCCTTTCCATTTTCACTTATGGACAAGGCCAAAGATTGGCTCTACGAACTAGCCCCGGGAACTGTGACTTCGTGGGAGAGTATGAAGCGTGCTTTCTTGGAGAAATTCTTCCCTACTTCGAGAGTGATTCTCCTACGGAAGAAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

196

Amino Acids

22.07

Weight (kDa)

4.43

Isoelectric Point (pI)

72.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 116, 475
AclWI GGATC 1 cut(s) 168
AcsI RAATTY 2 cut(s) 292, 543
AfiI CCNNNNNNNGG 2 cut(s) 116, 475
AgsI TTSAA 6 cut(s) 59, 125, 173, 298, 371, 431
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 12, 217
AluI AGCT 2 cut(s) 12, 217
AlwI GGATC 1 cut(s) 168
Ama87I CYCGRG 2 cut(s) 226, 494
AoxI GGCC 4 cut(s) 17, 222, 439, 466
ApeKI GCWGC 2 cut(s) 191, 271
ApoI RAATTY 2 cut(s) 292, 543
ArsI GACNNNNNNTTYG 2 cut(s) 38, 70
Asp700I GAANNNNTTC 2 cut(s) 375, 546
AsuC2I CCSGG 2 cut(s) 495, 496
AsuHPI GGTGA 1 cut(s) 62
AvaI CYCGRG 2 cut(s) 226, 494
BbsI GAAGAC 2 cut(s) 135, 359
BbvI GCAGC 2 cut(s) 203, 258
BccI CCATC 2 cut(s) 215, 411
BceAI ACGGC 1 cut(s) 284
BciT130I CCWGG 1 cut(s) 117
BciVI GTATCC 1 cut(s) 266
BcnI CCSGG 2 cut(s) 495, 496
BfaI CTAG 1 cut(s) 489
BfuI GTATCC 1 cut(s) 266
BisI GCNGC 2 cut(s) 192, 272
BlsI GCNGC 2 cut(s) 193, 273
Bme1390I CCNGG 3 cut(s) 117, 495, 496
BmeT110I CYCGRG 2 cut(s) 226, 494
BmrFI CCNGG 3 cut(s) 117, 495, 496
BoxI GACNNNNGTC 1 cut(s) 405
BpiI GAAGAC 2 cut(s) 135, 359
BplI GAGNNNNNCTC 4 cut(s) 20, 52, 553, 585
BpuMI CCSGG 2 cut(s) 495, 496
BsaJI CCNNGG 9 cut(s) 116, 156, 186, 225, 266, 276, 336, 493, 494
Bsc4I CCNNNNNNNGG 2 cut(s) 116, 475
Bse1I ACTGG 1 cut(s) 308
Bse3DI GCAATG 1 cut(s) 242
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 9 cut(s) 116, 156, 186, 225, 266, 276, 336, 493, 494
BseGI GGATG 1 cut(s) 422
BseLI CCNNNNNNNGG 2 cut(s) 116, 475
BseMI GCAATG 1 cut(s) 242
BseNI ACTGG 1 cut(s) 308
BseRI GAGGAG 2 cut(s) 85, 94
BseXI GCAGC 2 cut(s) 203, 258
BshFI GGCC 4 cut(s) 19, 224, 441, 468
BsiHKCI CYCGRG 2 cut(s) 226, 494
BsiSI CCGG 1 cut(s) 495
BslI CCNNNNNNNGG 2 cut(s) 116, 475
BsnI GGCC 4 cut(s) 19, 224, 441, 468
BsoBI CYCGRG 2 cut(s) 226, 494
Bsp143I GATC 1 cut(s) 160
Bsp19I CCATGG 2 cut(s) 186, 336
BspANI GGCC 4 cut(s) 19, 224, 441, 468
BspPI GGATC 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 242
BsrI ACTGG 1 cut(s) 308
BssECI CCNNGG 9 cut(s) 116, 156, 186, 225, 266, 276, 336, 493, 494
BssMI GATC 1 cut(s) 160
BssT1I CCWWGG 3 cut(s) 186, 276, 336
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 2 cut(s) 50, 503
BstC8I GCNNGC 1 cut(s) 529
BstDSI CCRYGG 4 cut(s) 156, 186, 266, 336
BstF5I GGATG 1 cut(s) 422
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNI CCWGG 1 cut(s) 117
BstPAI GACNNNNGTC 1 cut(s) 405
BstSCI CCNGG 3 cut(s) 115, 493, 494
BstV1I GCAGC 2 cut(s) 203, 258
BstV2I GAAGAC 2 cut(s) 135, 359
BsuI GTATCC 1 cut(s) 266
BsuRI GGCC 4 cut(s) 19, 224, 441, 468
BtgI CCRYGG 4 cut(s) 156, 186, 266, 336
BtsCI GGATG 1 cut(s) 422
Cac8I GCNNGC 1 cut(s) 529
Cfr9I CCCGGG 1 cut(s) 494
CviAII CATG 3 cut(s) 187, 337, 398
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
Eco130I CCWWGG 3 cut(s) 186, 276, 336
Eco147I AGGCCT 1 cut(s) 441
Eco88I CYCGRG 2 cut(s) 226, 494
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 3 cut(s) 186, 276, 336
EcoT22I ATGCAT 1 cut(s) 244
ErhI CCWWGG 3 cut(s) 186, 276, 336
FaeI CATG 3 cut(s) 190, 340, 401
FaiI YATR 9 cut(s) 26, 188, 323, 338, 349, 399, 426, 459, 522
FatI CATG 3 cut(s) 186, 336, 397
Fnu4HI GCNGC 2 cut(s) 192, 272
FokI GGATG 1 cut(s) 429
Fsp4HI GCNGC 2 cut(s) 192, 272
FspBI CTAG 1 cut(s) 489
GluI GCNGC 2 cut(s) 192, 272
HaeIII GGCC 4 cut(s) 19, 224, 441, 468
HapII CCGG 1 cut(s) 495
Hin1II CATG 3 cut(s) 190, 340, 401
HincII GTYRAC 1 cut(s) 86
HindII GTYRAC 1 cut(s) 86
HinfI GANTC 3 cut(s) 4, 82, 566
HpaII CCGG 1 cut(s) 495
HphI GGTGA 1 cut(s) 62
Hpy166II GTNNAC 1 cut(s) 86
Hpy188I TCNGA 3 cut(s) 40, 165, 329
Hpy188III TCNNGA 2 cut(s) 233, 559
Hpy8I GTNNAC 1 cut(s) 86
HpyAV CCTTC 2 cut(s) 365, 431
HpyCH4III ACNGT 2 cut(s) 50, 503
HpyCH4V TGCA 1 cut(s) 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
Hsp92II CATG 3 cut(s) 190, 340, 401
Kzo9I GATC 1 cut(s) 160
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 5 cut(s) 102, 129, 218, 321, 508
Lsp1109I GCAGC 2 cut(s) 203, 258
MaeI CTAG 1 cut(s) 489
MaeIII GTNAC 2 cut(s) 314, 503
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 8 cut(s) 137, 140, 158, 185, 188, 364, 443, 539
MluCI AATT 3 cut(s) 292, 543, 583
MlyI GAGTC 1 cut(s) 91
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 6 cut(s) 63, 72, 114, 235, 258, 374
Mph1103I ATGCAT 1 cut(s) 244
MroXI GAANNNNTTC 2 cut(s) 375, 546
MspI CCGG 1 cut(s) 495
MspR9I CCNGG 3 cut(s) 117, 495, 496
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 191
NciI CCSGG 2 cut(s) 495, 496
NcoI CCATGG 2 cut(s) 186, 336
NdeII GATC 1 cut(s) 160
NlaIII CATG 3 cut(s) 190, 340, 401
NmuCI GTSAC 1 cut(s) 503
NsiI ATGCAT 1 cut(s) 244
PceI AGGCCT 1 cut(s) 441
PdmI GAANNNNTTC 2 cut(s) 375, 546
PfeI GAWTC 1 cut(s) 566
PflMI CCANNNNNTGG 2 cut(s) 116, 475
PkrI GCNGC 2 cut(s) 193, 273
PleI GAGTC 1 cut(s) 90
PpsI GAGTC 1 cut(s) 90
PshAI GACNNNNGTC 1 cut(s) 405
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
SatI GCNGC 2 cut(s) 192, 272
Sau3AI GATC 1 cut(s) 160
SchI GAGTC 1 cut(s) 91
ScrFI CCNGG 3 cut(s) 117, 495, 496
SetI ASST 6 cut(s) 14, 106, 118, 142, 219, 385
SmaI CCCGGG 1 cut(s) 496
Sse9I AATT 3 cut(s) 292, 543, 583
SseBI AGGCCT 1 cut(s) 441
SspMI CTAG 1 cut(s) 489
StuI AGGCCT 1 cut(s) 441
StyD4I CCNGG 3 cut(s) 115, 493, 494
StyI CCWWGG 3 cut(s) 186, 276, 336
TaaI ACNGT 2 cut(s) 50, 503
TaqI TCGA 3 cut(s) 379, 393, 558
TaqII GACCGA 1 cut(s) 301
TasI AATT 3 cut(s) 292, 543, 583
TfiI GAWTC 1 cut(s) 566
TseFI GTSAC 1 cut(s) 503
TseI GCWGC 2 cut(s) 191, 271
Tsp45I GTSAC 1 cut(s) 503
TspDTI ATGAA 3 cut(s) 305, 450, 537
TspGWI ACGGA 1 cut(s) 173
TspMI CCCGGG 1 cut(s) 494
Van91I CCANNNNNTGG 2 cut(s) 116, 475
XapI RAATTY 2 cut(s) 292, 543
XmaI CCCGGG 1 cut(s) 494
XmnI GAANNNNTTC 2 cut(s) 375, 546
XspI CTAG 1 cut(s) 489
Zsp2I ATGCAT 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.