pycom13g26470

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
23072778 .. 23073353
576 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 495 bp
ATGACTTTCGCTCAATTCCAAGGCAAGCCTTTCTGTGAGAGTTTGGAGAGATTTAGAGACTTGTTATTAAAATGTCCACATCACGGTTTGCCGAAATGGTTGCAGCTTCAGTTTTTCTATCAAGGTTTGAATGCTGACAATAAACGAATGATAAATCCTGCTAGTAGGGGTGCTATAATGACTAAGACCATTGACGAAGCATCTACACTTTTCAATACCTTGAAAGCTGGTGTATATGAAATTGATTCATTTGCAATTATGGCTGCCCAAATTTCTAACTTAAATAAGAAATTTGATTCTTTAATATGTTCTAATCAGTCAAAGATGATTTCCAATATGTGTGAAATTTGTGTAGGTACACATTCTACTATGGATTGTCCTATGAAGGTGGAAACTTCAATCACCAATAGTTTAATCCATTCTCTAACAAGTATAATCTTGGTTGGCATCATCATTCCAATTTTGCTTGGAAGAACAATCAATAAAATCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

165

Amino Acids

18.37

Weight (kDa)

8.96

Isoelectric Point (pI)

32.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 270, 290, 345
AcuI CTGAAG 1 cut(s) 92
AfaI GTAC 1 cut(s) 358
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 4 cut(s) 130, 214, 223, 399
AluBI AGCT 2 cut(s) 106, 227
AluI AGCT 2 cut(s) 106, 227
Alw26I GTCTC 1 cut(s) 51
ApeKI GCWGC 2 cut(s) 103, 263
ApoI RAATTY 3 cut(s) 270, 290, 345
AsuHPI GGTGA 1 cut(s) 394
BbvI GCAGC 2 cut(s) 115, 250
BcgI CGANNNNNNTGC 2 cut(s) 82, 116
BcoDI GTCTC 1 cut(s) 51
BfaI CTAG 1 cut(s) 162
BisI GCNGC 2 cut(s) 104, 264
BlsI GCNGC 2 cut(s) 105, 265
BmsI GCATC 2 cut(s) 209, 456
BsaJI CCNNGG 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 83
BseXI GCAGC 2 cut(s) 115, 250
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 51
BsmI GAATGC 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 19
Bst4CI ACNGT 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 183
BstMAI GTCTC 1 cut(s) 51
BstMWI GCNNNNNNNGC 1 cut(s) 260
BstV1I GCAGC 2 cut(s) 115, 250
Cac8I GCNNGC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 357
CviJI RGCY 4 cut(s) 28, 106, 227, 263
CviKI_1 RGCY 4 cut(s) 28, 106, 227, 263
CviQI GTAC 1 cut(s) 357
DdeI CTNAG 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 19
Eco57I CTGAAG 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 19
ErhI CCWWGG 1 cut(s) 19
FaiI YATR 9 cut(s) 176, 235, 237, 260, 307, 338, 371, 383, 434
Fnu4HI GCNGC 2 cut(s) 104, 264
Fsp4HI GCNGC 2 cut(s) 104, 264
FspBI CTAG 1 cut(s) 162
GluI GCNGC 2 cut(s) 104, 264
HinfI GANTC 2 cut(s) 245, 296
HphI GGTGA 1 cut(s) 394
Hpy166II GTNNAC 2 cut(s) 77, 359
Hpy8I GTNNAC 2 cut(s) 77, 359
HpyAV CCTTC 1 cut(s) 379
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 2 cut(s) 103, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 260
HpyF3I CTNAG 1 cut(s) 183
LpnPI CCDG 2 cut(s) 171, 213
Lsp1109I GCAGC 2 cut(s) 115, 250
LweI GCATC 2 cut(s) 209, 456
MaeI CTAG 1 cut(s) 162
MboII GAAGA 1 cut(s) 483
MluCI AATT 7 cut(s) 14, 240, 255, 270, 290, 345, 459
MseI TTAA 4 cut(s) 68, 281, 302, 413
Mva1269I GAATGC 1 cut(s) 136
MwoI GCNNNNNNNGC 1 cut(s) 260
PctI GAATGC 1 cut(s) 136
PfeI GAWTC 2 cut(s) 245, 296
PkrI GCNGC 2 cut(s) 105, 265
RsaI GTAC 1 cut(s) 358
RsaNI GTAC 1 cut(s) 357
SaqAI TTAA 4 cut(s) 68, 281, 302, 413
SatI GCNGC 2 cut(s) 104, 264
SetI ASST 6 cut(s) 108, 127, 221, 229, 358, 390
SfaNI GCATC 2 cut(s) 209, 456
Sse9I AATT 7 cut(s) 14, 240, 255, 270, 290, 345, 459
SspMI CTAG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 19
TaaI ACNGT 1 cut(s) 86
TasI AATT 7 cut(s) 14, 240, 255, 270, 290, 345, 459
TfiI GAWTC 2 cut(s) 245, 296
Tru1I TTAA 4 cut(s) 68, 281, 302, 413
Tru9I TTAA 4 cut(s) 68, 281, 302, 413
TseI GCWGC 2 cut(s) 103, 263
TspDTI ATGAA 3 cut(s) 237, 252, 398
XapI RAATTY 3 cut(s) 270, 290, 345
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.