pycom15g28760

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
24881390 .. 24883059
1670 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
ATGTTTGAATTCAATTTTCTTTGTTTTGTACTGGCAGCAGATAATAGAACCATCAAGGAGCTTTCGGCCTCGGGTTTAGATAATGCATTGCCTCTTTGTATCCAATACCCCACGGCTGCCCAAGGCAAGACCGATGAATTTGAACTCAAATCCAGTTTGTTACACCATATTCCGAAGTTCCATGGCTTGTCTATGGAAGACCCCAACAAACACTTGAAGGAGTTCGAGGTGGTTTGTTCGAGCATGACCCCCGTCAATGTGGATGGGAGTATATTGAAGATGAAGGCCTTTCCATTTTCACTTATGGACAAGGCCAAAGATTGGCTCTACGAACTAGCCCGGGAACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.16

Weight (kDa)

5.49

Isoelectric Point (pI)

23.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 321
AcsI RAATTY 2 cut(s) 8, 137
AfaI GTAC 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 321
AgsI TTSAA 5 cut(s) 8, 13, 143, 217, 277
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
Ama87I CYCGRG 2 cut(s) 70, 339
AoxI GGCC 3 cut(s) 66, 285, 312
ApeKI GCWGC 2 cut(s) 35, 116
ApoI RAATTY 2 cut(s) 8, 137
Asp700I GAANNNNTTC 1 cut(s) 221
AsuC2I CCSGG 2 cut(s) 340, 341
AvaI CYCGRG 2 cut(s) 70, 339
BbsI GAAGAC 1 cut(s) 204
BbvI GCAGC 2 cut(s) 47, 103
BccI CCATC 2 cut(s) 59, 257
BceAI ACGGC 1 cut(s) 129
BciVI GTATCC 1 cut(s) 110
BcnI CCSGG 2 cut(s) 340, 341
BfaI CTAG 1 cut(s) 335
BfuI GTATCC 1 cut(s) 110
BisI GCNGC 2 cut(s) 36, 117
BlsI GCNGC 2 cut(s) 37, 118
Bme1390I CCNGG 2 cut(s) 340, 341
BmeT110I CYCGRG 2 cut(s) 70, 339
BmrFI CCNGG 2 cut(s) 340, 341
BoxI GACNNNNGTC 1 cut(s) 251
BpiI GAAGAC 1 cut(s) 204
BpuMI CCSGG 2 cut(s) 340, 341
BsaJI CCNNGG 5 cut(s) 69, 111, 121, 181, 339
Bsc4I CCNNNNNNNGG 1 cut(s) 321
Bse1I ACTGG 2 cut(s) 36, 153
Bse3DI GCAATG 1 cut(s) 86
BseDI CCNNGG 5 cut(s) 69, 111, 121, 181, 339
BseGI GGATG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 321
BseMI GCAATG 1 cut(s) 86
BseNI ACTGG 2 cut(s) 36, 153
BseXI GCAGC 2 cut(s) 47, 103
BshFI GGCC 3 cut(s) 68, 287, 314
BsiHKCI CYCGRG 2 cut(s) 70, 339
BsiSI CCGG 1 cut(s) 340
BslI CCNNNNNNNGG 1 cut(s) 321
BsnI GGCC 3 cut(s) 68, 287, 314
BsoBI CYCGRG 2 cut(s) 70, 339
Bsp19I CCATGG 1 cut(s) 181
BspANI GGCC 3 cut(s) 68, 287, 314
BsrDI GCAATG 1 cut(s) 86
BsrI ACTGG 2 cut(s) 36, 153
BssECI CCNNGG 5 cut(s) 69, 111, 121, 181, 339
BssT1I CCWWGG 2 cut(s) 121, 181
Bst4CI ACNGT 1 cut(s) 348
BstDSI CCRYGG 2 cut(s) 111, 181
BstF5I GGATG 1 cut(s) 268
BstPAI GACNNNNGTC 1 cut(s) 251
BstSCI CCNGG 2 cut(s) 338, 339
BstV1I GCAGC 2 cut(s) 47, 103
BstV2I GAAGAC 1 cut(s) 204
BsuI GTATCC 1 cut(s) 110
BsuRI GGCC 3 cut(s) 68, 287, 314
BtgI CCRYGG 2 cut(s) 111, 181
BtsCI GGATG 1 cut(s) 268
Cfr9I CCCGGG 1 cut(s) 339
Csp6I GTAC 1 cut(s) 29
CviAII CATG 2 cut(s) 182, 244
CviJI RGCY 8 cut(s) 61, 68, 116, 186, 287, 314, 325, 338
CviKI_1 RGCY 8 cut(s) 61, 68, 116, 186, 287, 314, 325, 338
CviQI GTAC 1 cut(s) 29
Eco130I CCWWGG 2 cut(s) 121, 181
Eco147I AGGCCT 1 cut(s) 287
Eco88I CYCGRG 2 cut(s) 70, 339
EcoRI GAATTC 1 cut(s) 8
EcoT14I CCWWGG 2 cut(s) 121, 181
EcoT22I ATGCAT 1 cut(s) 88
ErhI CCWWGG 2 cut(s) 121, 181
FaeI CATG 2 cut(s) 185, 247
FaiI YATR 6 cut(s) 168, 183, 194, 245, 272, 305
FatI CATG 2 cut(s) 181, 243
Fnu4HI GCNGC 2 cut(s) 36, 117
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 2 cut(s) 36, 117
FspBI CTAG 1 cut(s) 335
GluI GCNGC 2 cut(s) 36, 117
HaeIII GGCC 3 cut(s) 68, 287, 314
HapII CCGG 1 cut(s) 340
Hin1II CATG 2 cut(s) 185, 247
HpaII CCGG 1 cut(s) 340
Hpy188I TCNGA 1 cut(s) 174
HpyAV CCTTC 2 cut(s) 211, 277
HpyCH4III ACNGT 1 cut(s) 348
HpyCH4V TGCA 1 cut(s) 86
Hsp92II CATG 2 cut(s) 185, 247
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 2 cut(s) 17, 166
Lsp1109I GCAGC 2 cut(s) 47, 103
MaeI CTAG 1 cut(s) 335
MaeIII GTNAC 1 cut(s) 159
MboII GAAGA 2 cut(s) 209, 289
MluCI AATT 3 cut(s) 8, 13, 137
MnlI CCTC 3 cut(s) 79, 102, 220
Mph1103I ATGCAT 1 cut(s) 88
MroXI GAANNNNTTC 1 cut(s) 221
MspI CCGG 1 cut(s) 340
MspR9I CCNGG 2 cut(s) 340, 341
NciI CCSGG 2 cut(s) 340, 341
NcoI CCATGG 1 cut(s) 181
NlaIII CATG 2 cut(s) 185, 247
NsiI ATGCAT 1 cut(s) 88
PceI AGGCCT 1 cut(s) 287
PdmI GAANNNNTTC 1 cut(s) 221
PflMI CCANNNNNTGG 1 cut(s) 321
PkrI GCNGC 2 cut(s) 37, 118
PshAI GACNNNNGTC 1 cut(s) 251
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
SatI GCNGC 2 cut(s) 36, 117
ScrFI CCNGG 2 cut(s) 340, 341
SetI ASST 2 cut(s) 63, 231
SmaI CCCGGG 1 cut(s) 341
Sse9I AATT 3 cut(s) 8, 13, 137
SseBI AGGCCT 1 cut(s) 287
SspMI CTAG 1 cut(s) 335
StuI AGGCCT 1 cut(s) 287
StyD4I CCNGG 2 cut(s) 338, 339
StyI CCWWGG 2 cut(s) 121, 181
TaaI ACNGT 1 cut(s) 348
TaqI TCGA 2 cut(s) 225, 239
TaqII GACCGA 1 cut(s) 146
TasI AATT 3 cut(s) 8, 13, 137
TatI WGTACW 1 cut(s) 28
TseI GCWGC 2 cut(s) 35, 116
TspDTI ATGAA 2 cut(s) 150, 296
TspMI CCCGGG 1 cut(s) 339
Van91I CCANNNNNTGG 1 cut(s) 321
XapI RAATTY 2 cut(s) 8, 137
XmaI CCCGGG 1 cut(s) 339
XmnI GAANNNNTTC 1 cut(s) 221
XspI CTAG 1 cut(s) 335
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.