pycom17g12970

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
10669585 .. 10669974
390 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 390 bp
ATGAAAGCTTTTCCATTCTCTCTTTTGGAAAAAGCTAAGGATTGGTTGTATGAATTGGCACTTGGAACCGTCACGTCTAGGGAAAGCATGAAGAGAGCATTCTTAGAAAAATTTTTCCCAACTTCAAGAGTCATTCTTTTGAGGAAGAAGATTAGTGGCATTCAACAAAACCAAGGAGAATCTTTTCCAACATATTATGAGCGTTTCAAGACTCTAGTTGCATCATGCCCTCAACACCAAATGAAAGAAGAGCTTCTAATTCAATATTTCTACGAAGGACTCCTTCCAATTGAAAGACAAATGCTAGATGCTTCGGTATGTGGTGATTTGGTTGACAAAACACCAATTGATGCCAAGACTTTAATTGCAAATCGAGCCTTGAATGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

14.87

Weight (kDa)

8.89

Isoelectric Point (pI)

38.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 3 - 95 3.3e-17 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 110
AgsI TTSAA 6 cut(s) 126, 164, 208, 263, 293, 382
AjiI CACGTC 1 cut(s) 75
AjuI GAANNNNNNNTTGG 2 cut(s) 45, 77
AluBI AGCT 3 cut(s) 8, 35, 253
AluI AGCT 3 cut(s) 8, 35, 253
ApoI RAATTY 1 cut(s) 110
Asp700I GAANNNNTTC 2 cut(s) 183, 252
AsuHPI GGTGA 1 cut(s) 335
BfaI CTAG 3 cut(s) 78, 215, 305
BmgBI CACGTC 1 cut(s) 75
BmiI GGNNCC 1 cut(s) 67
BmsI GCATC 3 cut(s) 230, 298, 340
Bpu10I CCTNAGC 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 172
BseDI CCNNGG 1 cut(s) 172
BsmI GAATGC 3 cut(s) 98, 159, 388
BspLI GGNNCC 1 cut(s) 67
BspQI GCTCTTC 1 cut(s) 243
BssECI CCNNGG 1 cut(s) 172
BssT1I CCWWGG 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 70
Bst6I CTCTTC 2 cut(s) 86, 243
BstDEI CTNAG 2 cut(s) 36, 103
BstMWI GCNNNNNNNGC 2 cut(s) 374, 383
BtrI CACGTC 1 cut(s) 75
CviAII CATG 2 cut(s) 88, 225
CviJI RGCY 4 cut(s) 8, 35, 253, 377
CviKI_1 RGCY 4 cut(s) 8, 35, 253, 377
DdeI CTNAG 2 cut(s) 36, 103
Eam1104I CTCTTC 2 cut(s) 86, 243
EarI CTCTTC 2 cut(s) 86, 243
Eco130I CCWWGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 172
EcoT22I ATGCAT 1 cut(s) 388
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 2 cut(s) 91, 228
FaiI YATR 7 cut(s) 51, 89, 193, 198, 226, 319, 388
FalI AAGNNNNNCTT 4 cut(s) 237, 269, 267, 299
FatI CATG 2 cut(s) 87, 224
FspBI CTAG 3 cut(s) 78, 215, 305
Hin1II CATG 2 cut(s) 91, 228
HincII GTYRAC 1 cut(s) 334
HindII GTYRAC 1 cut(s) 334
HindIII AAGCTT 1 cut(s) 6
HinfI GANTC 4 cut(s) 129, 179, 211, 279
HphI GGTGA 1 cut(s) 335
Hpy166II GTNNAC 1 cut(s) 334
Hpy188III TCNNGA 2 cut(s) 126, 208
Hpy8I GTNNAC 1 cut(s) 334
HpyAV CCTTC 2 cut(s) 269, 293
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 1 cut(s) 74
HpyCH4V TGCA 3 cut(s) 221, 368, 386
HpyF10VI GCNNNNNNNGC 2 cut(s) 374, 383
HpyF3I CTNAG 2 cut(s) 36, 103
HpySE526I ACGT 1 cut(s) 74
Hsp92II CATG 2 cut(s) 91, 228
LguI GCTCTTC 1 cut(s) 243
LweI GCATC 3 cut(s) 230, 298, 340
MaeI CTAG 3 cut(s) 78, 215, 305
MaeII ACGT 1 cut(s) 74
MaeIII GTNAC 1 cut(s) 70
MboII GAAGA 4 cut(s) 103, 157, 160, 260
MfeI CAATTG 2 cut(s) 288, 345
MluCI AATT 6 cut(s) 53, 110, 258, 288, 345, 363
MlyI GAGTC 3 cut(s) 138, 205, 273
MmeI TCCRAC 1 cut(s) 212
MnlI CCTC 2 cut(s) 135, 240
Mph1103I ATGCAT 1 cut(s) 388
MroXI GAANNNNTTC 2 cut(s) 183, 252
MseI TTAA 1 cut(s) 362
MunI CAATTG 2 cut(s) 288, 345
Mva1269I GAATGC 3 cut(s) 98, 159, 388
MwoI GCNNNNNNNGC 2 cut(s) 374, 383
NlaIII CATG 2 cut(s) 91, 228
NlaIV GGNNCC 1 cut(s) 67
NmuCI GTSAC 1 cut(s) 70
NsiI ATGCAT 1 cut(s) 388
PciSI GCTCTTC 1 cut(s) 243
PctI GAATGC 3 cut(s) 98, 159, 388
PdmI GAANNNNTTC 2 cut(s) 183, 252
PfeI GAWTC 1 cut(s) 179
PleI GAGTC 3 cut(s) 137, 205, 273
PpsI GAGTC 3 cut(s) 137, 205, 273
PspN4I GGNNCC 1 cut(s) 67
SapI GCTCTTC 1 cut(s) 243
SaqAI TTAA 1 cut(s) 362
SchI GAGTC 3 cut(s) 138, 205, 273
SetI ASST 4 cut(s) 10, 37, 77, 255
SfaNI GCATC 3 cut(s) 230, 298, 340
Sse9I AATT 6 cut(s) 53, 110, 258, 288, 345, 363
SspI AATATT 1 cut(s) 266
SspMI CTAG 3 cut(s) 78, 215, 305
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 1 cut(s) 77
TaqI TCGA 1 cut(s) 373
TasI AATT 6 cut(s) 53, 110, 258, 288, 345, 363
TfiI GAWTC 1 cut(s) 179
Tru1I TTAA 1 cut(s) 362
Tru9I TTAA 1 cut(s) 362
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 4 cut(s) 17, 66, 104, 257
XapI RAATTY 1 cut(s) 110
XmnI GAANNNNTTC 2 cut(s) 183, 252
XspI CTAG 3 cut(s) 78, 215, 305
Zsp2I ATGCAT 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.