RchiOBHm_Chr2g0139381

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
57003899 .. 57004920
1022 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGCGATATATGAAATATATTATAAATGATGATACTCTTTCATTTTCAACCAAGTGGGCGGCAAAGAGTCGGAACTCATATACCCAAGAGCAACTTGATGAGGTGTGCATTGAAGTGGCTGACTACTTGCAGAGTTTGCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.58

Weight (kDa)

4.66

Isoelectric Point (pI)

44.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000328)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g13832 FvH4_3g26701 FvH4_4g14350 FvH4_7g17370
malus_domestica MD12G1077900.v1.1 MD14G1070200.v1.1
prunus_persica Prupe.2G073100_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0365191 RchiOBHm_Chr2g0105141 RchiOBHm_Chr2g0120431 RchiOBHm_Chr2g0139381 RchiOBHm_Chr3g0494421 RchiOBHm_Chr6g0248181 RchiOBHm_Chr7g0235571
rosa_laevigata RLG00000005158 RLG00000008937 RLG00000013742 RLG00000015899 RLG00000019885 RLG00000024515 RLG00000024516 RLG00000028740 RLG00000030656 RLG00000030662 RLG00000032758 RLG00000035668 RLG00000036717 RLG00000036718
rosa_multiflora Rmu_sc0000252.1_g000016 Rmu_sc0001386.1_g000020 Rmu_sc0002271.1_g000010 Rmu_sc0003833.1_g000002 Rmu_sc0004718.1_g000004 Rmu_sc0006031.1_g000006 Rmu_sc0006598.1_g000013 Rmu_sc0007472.1_g000023 Rmu_sc0009313.1_g000012
rosa_roxburghii Rroxscaffold_2G00103830 Rroxscaffold_2G00109880 Rroxscaffold_3G00225910 Rroxscaffold_3G00271600 Rroxscaffold_3G00274560 Rroxscaffold_4G00299580 Rroxscaffold_5G00352530 Rroxscaffold_5G00379280 Rroxscaffold_7G00177320
rosa_rugosa Rorug01G0027200 Rorug01G0032100 Rorug02G0050600 Rorug02G0054800 Rorug04G0083300 Rorug05G0115200 Rorug07G0006800
rosa_samantha Rh1CG086700 Rh1DG093300 Rh1DG217000 Rh2AG120200 Rh2AG227900 Rh2AG254000 Rh2AG434200 Rh2AG469200 Rh2BG159500 Rh2CG419900 Rh2CG455200 Rh2DG320100 Rh2DG603500 Rh3CG319900 Rh3DG300800 Rh3DG319200 Rh4AG199400 Rh4BG329100 Rh4BG329200 Rh4CG110800 Rh4DG042000 Rh4DG129400 Rh4DG187700 Rh4DG231900 Rh5AG038800 Rh5AG107300 Rh5AG303600 Rh5AG386500 Rh5AG454200 Rh5CG041800 Rh5CG534800 Rh5DG076400 Rh5DG109800 Rh5DG123600 Rh6AG164400 Rh6BG035100 Rh6BG036000 Rh6BG041000 Rh6BG215500 Rh6CG173900 Rh6CG174000 Rh6DG020300 Rh6DG166300 Rh6DG320000 Rh6DG509700 Rh7AG059500 Rh7AG291700 Rh7BG404300 Rh7DG402000
rosa_wichuraiana Rw1G000890 Rw1G020020 Rw3G005730 Rw4G011330 Rw4G026960 Rw5G014010 Rw6G002230 Rw7G038480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AciI CCGC 1 cut(s) 59
AgsI TTSAA 2 cut(s) 48, 113
BfmI CTRYAG 1 cut(s) 140
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BspACI CCGC 1 cut(s) 59
BstAPI GCANNNNNTGC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstSFI CTRYAG 1 cut(s) 140
CviJI RGCY 1 cut(s) 119
CviKI_1 RGCY 1 cut(s) 119
FaiI YATR 7 cut(s) 9, 11, 18, 23, 79, 81, 142
FalI AAGNNNNNCTT 2 cut(s) 78, 110
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
FspEI CC 9 cut(s) 40, 41, 44, 55, 64, 86, 97, 98, 101
GluI GCNGC 1 cut(s) 60
HinfI GANTC 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 72
HpyCH4V TGCA 2 cut(s) 108, 130
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
MlyI GAGTC 1 cut(s) 76
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 1 cut(s) 94
MslI CAYNNNNRTG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 136
PkrI GCNGC 1 cut(s) 61
PleI GAGTC 1 cut(s) 75
PpsI GAGTC 1 cut(s) 75
PsiI TTATAA 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 113
SatI GCNGC 1 cut(s) 60
SchI GAGTC 1 cut(s) 76
SetI ASST 1 cut(s) 105
SfcI CTRYAG 1 cut(s) 140
SgeI CNNG 4 cut(s) 64, 98, 107, 139
SmiMI CAYNNNNRTG 1 cut(s) 113
SsiI CCGC 1 cut(s) 59
TauI GCSGC 1 cut(s) 62
TspDTI ATGAA 2 cut(s) 26, 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.