Rmu_sc0001386.1_g000020

Mitochondrial inner membrane protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001386.1
OG0000328
Physical Location & Seq
Forward (+)
72753 .. 73803
1051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001386.1_g000020.1.cds

Sequence Viewer

Length: 369 bp
atggctgagaaagttccgtcttttcaaaatggtggagctctttggtttactgatctcacaactccagatagcatgttgatccttccaattctaacaccaatgacattttggatcacagtcgagtgcaacatgcaggaaggtctggaaggaaatcctgttacgcaaactatgaaaccctattctagaatcctagctgtcattgcaattccagttatgatgagcttcctcaaggcactcctttatgtctacagtgccatcgcacaagagaacataaagcagtgggcggcaaagagtcggaactcatatacccaagagcaacttgatgaggtgcggattgaagcggctgactacttgcagactttgctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0016020
KEGG Pathways
Metabolic & Signaling
ko02024 ko03060 ko03070 map02024 map03060 map03070
Pfam Domains
Protein Families
60KD_IMP

Protein Analysis

122

Amino Acids

13.81

Weight (kDa)

4.64

Isoelectric Point (pI)

45.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000328)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g13832 FvH4_3g26701 FvH4_4g14350 FvH4_7g17370
malus_domestica MD12G1077900.v1.1 MD14G1070200.v1.1
prunus_persica Prupe.2G073100_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0365191 RchiOBHm_Chr2g0105141 RchiOBHm_Chr2g0120431 RchiOBHm_Chr2g0139381 RchiOBHm_Chr3g0494421 RchiOBHm_Chr6g0248181 RchiOBHm_Chr7g0235571
rosa_laevigata RLG00000005158 RLG00000008937 RLG00000013742 RLG00000015899 RLG00000019885 RLG00000024515 RLG00000024516 RLG00000028740 RLG00000030656 RLG00000030662 RLG00000032758 RLG00000035668 RLG00000036717 RLG00000036718
rosa_multiflora Rmu_sc0000252.1_g000016 Rmu_sc0001386.1_g000020 Rmu_sc0002271.1_g000010 Rmu_sc0003833.1_g000002 Rmu_sc0004718.1_g000004 Rmu_sc0006031.1_g000006 Rmu_sc0006598.1_g000013 Rmu_sc0007472.1_g000023 Rmu_sc0009313.1_g000012
rosa_roxburghii Rroxscaffold_2G00103830 Rroxscaffold_2G00109880 Rroxscaffold_3G00225910 Rroxscaffold_3G00271600 Rroxscaffold_3G00274560 Rroxscaffold_4G00299580 Rroxscaffold_5G00352530 Rroxscaffold_5G00379280 Rroxscaffold_7G00177320
rosa_rugosa Rorug01G0027200 Rorug01G0032100 Rorug02G0050600 Rorug02G0054800 Rorug04G0083300 Rorug05G0115200 Rorug07G0006800
rosa_samantha Rh1CG086700 Rh1DG093300 Rh1DG217000 Rh2AG120200 Rh2AG227900 Rh2AG254000 Rh2AG434200 Rh2AG469200 Rh2BG159500 Rh2CG419900 Rh2CG455200 Rh2DG320100 Rh2DG603500 Rh3CG319900 Rh3DG300800 Rh3DG319200 Rh4AG199400 Rh4BG329100 Rh4BG329200 Rh4CG110800 Rh4DG042000 Rh4DG129400 Rh4DG187700 Rh4DG231900 Rh5AG038800 Rh5AG107300 Rh5AG303600 Rh5AG386500 Rh5AG454200 Rh5CG041800 Rh5CG534800 Rh5DG076400 Rh5DG109800 Rh5DG123600 Rh6AG164400 Rh6BG035100 Rh6BG036000 Rh6BG041000 Rh6BG215500 Rh6CG173900 Rh6CG174000 Rh6DG020300 Rh6DG166300 Rh6DG320000 Rh6DG509700 Rh7AG059500 Rh7AG291700 Rh7BG404300 Rh7DG402000
rosa_wichuraiana Rw1G000890 Rw1G020020 Rw3G005730 Rw4G011330 Rw4G026960 Rw5G014010 Rw6G002230 Rw7G038480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 246
AciI CCGC 3 cut(s) 284, 331, 341
AclWI GGATC 2 cut(s) 73, 119
AgsI TTSAA 2 cut(s) 26, 338
AluBI AGCT 3 cut(s) 38, 194, 222
AluI AGCT 3 cut(s) 38, 194, 222
Alw21I GWGCWC 1 cut(s) 40
AlwI GGATC 2 cut(s) 73, 119
BanII GRGCYC 1 cut(s) 40
Bbv12I GWGCWC 1 cut(s) 40
BccI CCATC 1 cut(s) 263
BfaI CTAG 2 cut(s) 183, 191
BfmI CTRYAG 2 cut(s) 247, 365
BisI GCNGC 2 cut(s) 285, 342
BlsI GCNGC 2 cut(s) 286, 343
BpmI CTGGAG 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 212
Bse1I ACTGG 1 cut(s) 209
Bse3DI GCAATG 1 cut(s) 198
BseMI GCAATG 1 cut(s) 198
BseNI ACTGG 1 cut(s) 209
BsiHKAI GWGCWC 1 cut(s) 40
Bsp1286I GDGCHC 1 cut(s) 40
Bsp143I GATC 3 cut(s) 52, 78, 111
BspACI CCGC 3 cut(s) 284, 331, 341
BspPI GGATC 2 cut(s) 73, 119
BsrDI GCAATG 1 cut(s) 198
BsrI ACTGG 1 cut(s) 209
BssMI GATC 3 cut(s) 52, 78, 111
Bst4CI ACNGT 2 cut(s) 118, 251
BstAPI GCANNNNNTGC 1 cut(s) 361
BstDEI CTNAG 1 cut(s) 6
BstKTI GATC 3 cut(s) 55, 81, 114
BstMBI GATC 3 cut(s) 52, 78, 111
BstMWI GCNNNNNNNGC 2 cut(s) 200, 361
BstNSI RCATGY 2 cut(s) 76, 133
BstSFI CTRYAG 2 cut(s) 247, 365
BtgZI GCGATG 1 cut(s) 241
BtsI GCAGTG 1 cut(s) 284
BtsIMutI CAGTG 2 cut(s) 256, 284
CviAII CATG 2 cut(s) 73, 130
CviJI RGCY 5 cut(s) 5, 38, 194, 222, 344
CviKI_1 RGCY 5 cut(s) 5, 38, 194, 222, 344
DdeI CTNAG 1 cut(s) 6
DpnI GATC 3 cut(s) 54, 80, 113
DpnII GATC 3 cut(s) 52, 78, 111
Ecl136II GAGCTC 1 cut(s) 38
Eco24I GRGCYC 1 cut(s) 40
Eco53kI GAGCTC 1 cut(s) 38
EcoICRI GAGCTC 1 cut(s) 38
EcoT38I GRGCYC 1 cut(s) 40
FaeI CATG 2 cut(s) 76, 133
FaiI YATR 9 cut(s) 74, 131, 170, 215, 243, 272, 304, 306, 367
FalI AAGNNNNNCTT 2 cut(s) 303, 335
FatI CATG 2 cut(s) 72, 129
FblI GTMKAC 1 cut(s) 246
Fnu4HI GCNGC 2 cut(s) 285, 342
FriOI GRGCYC 1 cut(s) 40
Fsp4HI GCNGC 2 cut(s) 285, 342
FspBI CTAG 2 cut(s) 183, 191
GluI GCNGC 2 cut(s) 285, 342
GsuI CTGGAG 1 cut(s) 48
Hin1II CATG 2 cut(s) 76, 133
HinfI GANTC 2 cut(s) 186, 292
Hpy166II GTNNAC 2 cut(s) 48, 247
Hpy188I TCNGA 1 cut(s) 297
Hpy188III TCNNGA 3 cut(s) 65, 143, 183
Hpy8I GTNNAC 2 cut(s) 48, 247
HpyAV CCTTC 3 cut(s) 92, 131, 140
HpyCH4III ACNGT 2 cut(s) 118, 251
HpyCH4V TGCA 4 cut(s) 126, 133, 203, 355
HpyF10VI GCNNNNNNNGC 2 cut(s) 200, 361
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 2 cut(s) 76, 133
Kzo9I GATC 3 cut(s) 52, 78, 111
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 5 cut(s) 78, 119, 128, 168, 222
MaeI CTAG 2 cut(s) 183, 191
MaeIII GTNAC 1 cut(s) 157
MalI GATC 3 cut(s) 54, 80, 113
MboI GATC 3 cut(s) 52, 78, 111
MhlI GDGCHC 1 cut(s) 40
MluCI AATT 2 cut(s) 87, 204
MlyI GAGTC 1 cut(s) 301
MmeI TCCRAC 1 cut(s) 275
MnlI CCTC 2 cut(s) 236, 319
MwoI GCNNNNNNNGC 2 cut(s) 200, 361
NdeII GATC 3 cut(s) 52, 78, 111
NlaIII CATG 2 cut(s) 76, 133
NspI RCATGY 2 cut(s) 76, 133
PfeI GAWTC 1 cut(s) 186
PkrI GCNGC 2 cut(s) 286, 343
PleI GAGTC 1 cut(s) 300
PpsI GAGTC 1 cut(s) 300
Psp124BI GAGCTC 1 cut(s) 40
SacI GAGCTC 1 cut(s) 40
SatI GCNGC 2 cut(s) 285, 342
Sau3AI GATC 3 cut(s) 52, 78, 111
SchI GAGTC 1 cut(s) 301
SduI GDGCHC 1 cut(s) 40
SetI ASST 5 cut(s) 40, 142, 196, 224, 330
SfcI CTRYAG 2 cut(s) 247, 365
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 2 cut(s) 87, 204
SsiI CCGC 3 cut(s) 284, 331, 341
SspMI CTAG 2 cut(s) 183, 191
SstI GAGCTC 1 cut(s) 40
TaaI ACNGT 2 cut(s) 118, 251
TaqI TCGA 1 cut(s) 120
TasI AATT 2 cut(s) 87, 204
TauI GCSGC 2 cut(s) 287, 344
TfiI GAWTC 1 cut(s) 186
TscAI CASTG 2 cut(s) 256, 284
TspDTI ATGAA 1 cut(s) 185
TspGWI ACGGA 1 cut(s) 6
TspRI CASTG 2 cut(s) 256, 284
XbaI TCTAGA 1 cut(s) 182
XceI RCATGY 2 cut(s) 76, 133
XcmI CCANNNNNNNNNTGG 1 cut(s) 105
XmiI GTMKAC 1 cut(s) 246
XspI CTAG 2 cut(s) 183, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.