Rh5CG534800

Mitochondrial inner membrane protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
74899947 .. 74901014
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG534800.1

Sequence Viewer

Length: 342 bp
ATGGCTGAGAAAGTTCGGTCTTTTCAAAATGGTGGAGCTCTTTGGTTTACTGATCTCACAACTCCAGAGAGCATGTTGATCCTTCCAATTCTGACAGCAATGACATTCTGGATCACAGTCGAGCGTTTTCTCCTCAGTGCAACATGCAGGAAGGTCTGGAAAGGAAATCTTGTTGCACAAACTATGAAAACCTATTCTAGAATCCTAGCTGTCATTGAAATTCCAGTTATGATGAGCTTCCTCAAGGCACTCCTTTATGTCTACAGTGCCATCGCACAAGAGAACATAAAGCAGGATGTAGGAGCTCCAGTGAACAAAATAAATCAAATAATCAATTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.76

Weight (kDa)

9.46

Isoelectric Point (pI)

46.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000328)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g13832 FvH4_3g26701 FvH4_4g14350 FvH4_7g17370
malus_domestica MD12G1077900.v1.1 MD14G1070200.v1.1
prunus_persica Prupe.2G073100_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0365191 RchiOBHm_Chr2g0105141 RchiOBHm_Chr2g0120431 RchiOBHm_Chr2g0139381 RchiOBHm_Chr3g0494421 RchiOBHm_Chr6g0248181 RchiOBHm_Chr7g0235571
rosa_laevigata RLG00000005158 RLG00000008937 RLG00000013742 RLG00000015899 RLG00000019885 RLG00000024515 RLG00000024516 RLG00000028740 RLG00000030656 RLG00000030662 RLG00000032758 RLG00000035668 RLG00000036717 RLG00000036718
rosa_multiflora Rmu_sc0000252.1_g000016 Rmu_sc0001386.1_g000020 Rmu_sc0002271.1_g000010 Rmu_sc0003833.1_g000002 Rmu_sc0004718.1_g000004 Rmu_sc0006031.1_g000006 Rmu_sc0006598.1_g000013 Rmu_sc0007472.1_g000023 Rmu_sc0009313.1_g000012
rosa_roxburghii Rroxscaffold_2G00103830 Rroxscaffold_2G00109880 Rroxscaffold_3G00225910 Rroxscaffold_3G00271600 Rroxscaffold_3G00274560 Rroxscaffold_4G00299580 Rroxscaffold_5G00352530 Rroxscaffold_5G00379280 Rroxscaffold_7G00177320
rosa_rugosa Rorug01G0027200 Rorug01G0032100 Rorug02G0050600 Rorug02G0054800 Rorug04G0083300 Rorug05G0115200 Rorug07G0006800
rosa_samantha Rh1CG086700 Rh1DG093300 Rh1DG217000 Rh2AG120200 Rh2AG227900 Rh2AG254000 Rh2AG434200 Rh2AG469200 Rh2BG159500 Rh2CG419900 Rh2CG455200 Rh2DG320100 Rh2DG603500 Rh3CG319900 Rh3DG300800 Rh3DG319200 Rh4AG199400 Rh4BG329100 Rh4BG329200 Rh4CG110800 Rh4DG042000 Rh4DG129400 Rh4DG187700 Rh4DG231900 Rh5AG038800 Rh5AG107300 Rh5AG303600 Rh5AG386500 Rh5AG454200 Rh5CG041800 Rh5CG534800 Rh5DG076400 Rh5DG109800 Rh5DG123600 Rh6AG164400 Rh6BG035100 Rh6BG036000 Rh6BG041000 Rh6BG215500 Rh6CG173900 Rh6CG174000 Rh6DG020300 Rh6DG166300 Rh6DG320000 Rh6DG509700 Rh7AG059500 Rh7AG291700 Rh7BG404300 Rh7DG402000
rosa_wichuraiana Rw1G000890 Rw1G020020 Rw3G005730 Rw4G011330 Rw4G026960 Rw5G014010 Rw6G002230 Rw7G038480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 261
AclWI GGATC 2 cut(s) 73, 119
AcsI RAATTY 1 cut(s) 219
AgsI TTSAA 2 cut(s) 26, 218
AluBI AGCT 4 cut(s) 38, 209, 237, 305
AluI AGCT 4 cut(s) 38, 209, 237, 305
Alw21I GWGCWC 2 cut(s) 40, 307
AlwI GGATC 2 cut(s) 73, 119
ApoI RAATTY 1 cut(s) 219
BanII GRGCYC 2 cut(s) 40, 307
Bbv12I GWGCWC 2 cut(s) 40, 307
BccI CCATC 1 cut(s) 278
BfaI CTAG 2 cut(s) 198, 206
BfmI CTRYAG 1 cut(s) 262
BpmI CTGGAG 2 cut(s) 48, 291
BpuEI CTTGAG 1 cut(s) 227
BsaXI ACNNNNNCTCC 2 cut(s) 294, 324
Bse1I ACTGG 2 cut(s) 224, 308
Bse3DI GCAATG 1 cut(s) 105
BseGI GGATG 1 cut(s) 301
BseMI GCAATG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 148
BseNI ACTGG 2 cut(s) 224, 308
BseRI GAGGAG 1 cut(s) 122
BsiHKAI GWGCWC 2 cut(s) 40, 307
Bsp1286I GDGCHC 2 cut(s) 40, 307
Bsp143I GATC 3 cut(s) 52, 78, 111
BspCNI CTCAG 1 cut(s) 147
BspPI GGATC 2 cut(s) 73, 119
BsrDI GCAATG 1 cut(s) 105
BsrI ACTGG 2 cut(s) 224, 308
BssMI GATC 3 cut(s) 52, 78, 111
Bst4CI ACNGT 2 cut(s) 118, 266
BstDEI CTNAG 2 cut(s) 6, 134
BstF5I GGATG 1 cut(s) 301
BstKTI GATC 3 cut(s) 55, 81, 114
BstMBI GATC 3 cut(s) 52, 78, 111
BstNSI RCATGY 2 cut(s) 76, 147
BstSFI CTRYAG 1 cut(s) 262
BtgZI GCGATG 1 cut(s) 256
BtsCI GGATG 1 cut(s) 301
BtsIMutI CAGTG 3 cut(s) 142, 271, 315
CviAII CATG 2 cut(s) 73, 144
CviJI RGCY 5 cut(s) 5, 38, 209, 237, 305
CviKI_1 RGCY 5 cut(s) 5, 38, 209, 237, 305
DdeI CTNAG 2 cut(s) 6, 134
DpnI GATC 3 cut(s) 54, 80, 113
DpnII GATC 3 cut(s) 52, 78, 111
Ecl136II GAGCTC 2 cut(s) 38, 305
Eco24I GRGCYC 2 cut(s) 40, 307
Eco53kI GAGCTC 2 cut(s) 38, 305
EcoICRI GAGCTC 2 cut(s) 38, 305
EcoT38I GRGCYC 2 cut(s) 40, 307
FaeI CATG 2 cut(s) 76, 147
FaiI YATR 6 cut(s) 74, 145, 185, 230, 258, 287
FalI AAGNNNNNCTT 2 cut(s) 153, 185
FatI CATG 2 cut(s) 72, 143
FblI GTMKAC 1 cut(s) 261
FokI GGATG 1 cut(s) 308
FriOI GRGCYC 2 cut(s) 40, 307
FspBI CTAG 2 cut(s) 198, 206
GsuI CTGGAG 2 cut(s) 48, 291
Hin1II CATG 2 cut(s) 76, 147
HinfI GANTC 1 cut(s) 201
Hpy166II GTNNAC 3 cut(s) 48, 262, 313
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 4 cut(s) 65, 109, 157, 198
Hpy8I GTNNAC 3 cut(s) 48, 262, 313
HpyAV CCTTC 2 cut(s) 92, 145
HpyCH4III ACNGT 2 cut(s) 118, 266
HpyCH4V TGCA 3 cut(s) 140, 147, 176
HpyF3I CTNAG 2 cut(s) 6, 134
Hsp92II CATG 2 cut(s) 76, 147
Kzo9I GATC 3 cut(s) 52, 78, 111
LmnI GCTCC 3 cut(s) 35, 302, 310
LpnPI CCDG 7 cut(s) 78, 94, 133, 142, 237, 278, 321
MaeI CTAG 2 cut(s) 198, 206
MalI GATC 3 cut(s) 54, 80, 113
MboI GATC 3 cut(s) 52, 78, 111
MhlI GDGCHC 2 cut(s) 40, 307
MluCI AATT 3 cut(s) 87, 219, 334
MnlI CCTC 2 cut(s) 143, 251
MseI TTAA 1 cut(s) 340
NdeII GATC 3 cut(s) 52, 78, 111
NlaIII CATG 2 cut(s) 76, 147
NspI RCATGY 2 cut(s) 76, 147
PfeI GAWTC 1 cut(s) 201
Psp124BI GAGCTC 2 cut(s) 40, 307
SacI GAGCTC 2 cut(s) 40, 307
SaqAI TTAA 1 cut(s) 340
Sau3AI GATC 3 cut(s) 52, 78, 111
SduI GDGCHC 2 cut(s) 40, 307
SetI ASST 6 cut(s) 40, 156, 194, 211, 239, 307
SfcI CTRYAG 1 cut(s) 262
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 3 cut(s) 87, 219, 334
SspMI CTAG 2 cut(s) 198, 206
SstI GAGCTC 2 cut(s) 40, 307
TaaI ACNGT 2 cut(s) 118, 266
TaqI TCGA 1 cut(s) 120
TaqII GACCGA 1 cut(s) 6
TasI AATT 3 cut(s) 87, 219, 334
TfiI GAWTC 1 cut(s) 201
Tru1I TTAA 1 cut(s) 340
Tru9I TTAA 1 cut(s) 340
TscAI CASTG 3 cut(s) 142, 271, 315
TspDTI ATGAA 1 cut(s) 200
TspRI CASTG 3 cut(s) 142, 271, 315
XapI RAATTY 1 cut(s) 219
XbaI TCTAGA 1 cut(s) 197
XceI RCATGY 2 cut(s) 76, 147
XmiI GTMKAC 1 cut(s) 261
XspI CTAG 2 cut(s) 198, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.