Rh6BG035100

Regulator of Vps4 activity in the MVB pathway

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
5703436 .. 5703766
331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG035100.1

Sequence Viewer

Length: 210 bp
ATGAATATTTTCTGGGATGACAGGGTTGGATGCCAAACTGAAAATTCTTACTGCAGCAAATCTGATGTAAAGAGAATAAAGGTGAGGCTAGGGGCGATTAAGAAGAAGAGGAACGCTGTGCTGAAGTATCTGAAGAATAATGTTGCTGTTCTTCTCAAGATTGGCCTTGATATTAATGTATATGGAGGGTTAAGTTTCATGGCTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.85

Weight (kDa)

9.88

Isoelectric Point (pI)

16.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000328)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g13832 FvH4_3g26701 FvH4_4g14350 FvH4_7g17370
malus_domestica MD12G1077900.v1.1 MD14G1070200.v1.1
prunus_persica Prupe.2G073100_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0365191 RchiOBHm_Chr2g0105141 RchiOBHm_Chr2g0120431 RchiOBHm_Chr2g0139381 RchiOBHm_Chr3g0494421 RchiOBHm_Chr6g0248181 RchiOBHm_Chr7g0235571
rosa_laevigata RLG00000005158 RLG00000008937 RLG00000013742 RLG00000015899 RLG00000019885 RLG00000024515 RLG00000024516 RLG00000028740 RLG00000030656 RLG00000030662 RLG00000032758 RLG00000035668 RLG00000036717 RLG00000036718
rosa_multiflora Rmu_sc0000252.1_g000016 Rmu_sc0001386.1_g000020 Rmu_sc0002271.1_g000010 Rmu_sc0003833.1_g000002 Rmu_sc0004718.1_g000004 Rmu_sc0006031.1_g000006 Rmu_sc0006598.1_g000013 Rmu_sc0007472.1_g000023 Rmu_sc0009313.1_g000012
rosa_roxburghii Rroxscaffold_2G00103830 Rroxscaffold_2G00109880 Rroxscaffold_3G00225910 Rroxscaffold_3G00271600 Rroxscaffold_3G00274560 Rroxscaffold_4G00299580 Rroxscaffold_5G00352530 Rroxscaffold_5G00379280 Rroxscaffold_7G00177320
rosa_rugosa Rorug01G0027200 Rorug01G0032100 Rorug02G0050600 Rorug02G0054800 Rorug04G0083300 Rorug05G0115200 Rorug07G0006800
rosa_samantha Rh1CG086700 Rh1DG093300 Rh1DG217000 Rh2AG120200 Rh2AG227900 Rh2AG254000 Rh2AG434200 Rh2AG469200 Rh2BG159500 Rh2CG419900 Rh2CG455200 Rh2DG320100 Rh2DG603500 Rh3CG319900 Rh3DG300800 Rh3DG319200 Rh4AG199400 Rh4BG329100 Rh4BG329200 Rh4CG110800 Rh4DG042000 Rh4DG129400 Rh4DG187700 Rh4DG231900 Rh5AG038800 Rh5AG107300 Rh5AG303600 Rh5AG386500 Rh5AG454200 Rh5CG041800 Rh5CG534800 Rh5DG076400 Rh5DG109800 Rh5DG123600 Rh6AG164400 Rh6BG035100 Rh6BG036000 Rh6BG041000 Rh6BG215500 Rh6CG173900 Rh6CG174000 Rh6DG020300 Rh6DG166300 Rh6DG320000 Rh6DG509700 Rh7AG059500 Rh7AG291700 Rh7BG404300 Rh7DG402000
rosa_wichuraiana Rw1G000890 Rw1G020020 Rw3G005730 Rw4G011330 Rw4G026960 Rw5G014010 Rw6G002230 Rw7G038480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AcuI CTGAAG 2 cut(s) 143, 152
AoxI GGCC 1 cut(s) 163
ApeKI GCWGC 1 cut(s) 54
ApoI RAATTY 1 cut(s) 43
AseI ATTAAT 1 cut(s) 174
Asp700I GAANNNNTTC 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 94
BbvI GCAGC 1 cut(s) 66
BfaI CTAG 1 cut(s) 89
BfmI CTRYAG 1 cut(s) 52
BisI GCNGC 1 cut(s) 55
BlsI GCNGC 1 cut(s) 56
BmsI GCATC 1 cut(s) 20
BpuEI CTTGAG 1 cut(s) 140
BseGI GGATG 2 cut(s) 22, 35
BseXI GCAGC 1 cut(s) 66
BshFI GGCC 1 cut(s) 165
BsnI GGCC 1 cut(s) 165
BspANI GGCC 1 cut(s) 165
BspMAI CTGCAG 1 cut(s) 56
Bst6I CTCTTC 1 cut(s) 101
BstF5I GGATG 2 cut(s) 22, 35
BstSFI CTRYAG 1 cut(s) 52
BstV1I GCAGC 1 cut(s) 66
BsuRI GGCC 1 cut(s) 165
BtsCI GGATG 2 cut(s) 22, 35
CviAII CATG 1 cut(s) 199
CviJI RGCY 3 cut(s) 88, 165, 203
CviKI_1 RGCY 3 cut(s) 88, 165, 203
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco57I CTGAAG 2 cut(s) 143, 152
FaeI CATG 1 cut(s) 202
FaiI YATR 3 cut(s) 181, 183, 200
FatI CATG 1 cut(s) 198
Fnu4HI GCNGC 1 cut(s) 55
FokI GGATG 2 cut(s) 29, 42
Fsp4HI GCNGC 1 cut(s) 55
FspBI CTAG 1 cut(s) 89
GluI GCNGC 1 cut(s) 55
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 1 cut(s) 202
HphI GGTGA 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 64, 132
Hpy188III TCNNGA 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 54
Hsp92II CATG 1 cut(s) 202
LpnPI CCDG 1 cut(s) 7
Lsp1109I GCAGC 1 cut(s) 66
LweI GCATC 1 cut(s) 20
MaeI CTAG 1 cut(s) 89
MboII GAAGA 4 cut(s) 115, 118, 143, 145
MluCI AATT 1 cut(s) 43
MmeI TCCRAC 1 cut(s) 7
MnlI CCTC 3 cut(s) 78, 102, 179
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 3 cut(s) 99, 174, 191
NlaIII CATG 1 cut(s) 202
PdmI GAANNNNTTC 1 cut(s) 8
PkrI GCNGC 1 cut(s) 56
PshBI ATTAAT 1 cut(s) 174
PstI CTGCAG 1 cut(s) 56
SaqAI TTAA 3 cut(s) 99, 174, 191
SatI GCNGC 1 cut(s) 55
SetI ASST 1 cut(s) 84
SfaNI GCATC 1 cut(s) 20
SfcI CTRYAG 1 cut(s) 52
SgeI CNNG 5 cut(s) 25, 34, 101, 169, 179
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 1 cut(s) 43
SspI AATATT 1 cut(s) 7
SspMI CTAG 1 cut(s) 89
TasI AATT 1 cut(s) 43
Tru1I TTAA 3 cut(s) 99, 174, 191
Tru9I TTAA 3 cut(s) 99, 174, 191
TseI GCWGC 1 cut(s) 54
TspDTI ATGAA 2 cut(s) 17, 187
VspI ATTAAT 1 cut(s) 174
XapI RAATTY 1 cut(s) 43
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.