Rmu_sc0004718.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004718.1
OG0000328
Physical Location & Seq
Forward (+)
11410 .. 14207
2798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004718.1_g000004.1.cds

Sequence Viewer

Length: 756 bp
atggatgaggcatttggtagtagagacattcaattgagttgggttgatgtgaggtatgaattggagtgtgatgttatggggatgcctttggagtgcaagttttgtgaccttgagttggctgagttgaaaacgttgcctagaagtagagctgatgatggcttgttttccgtggaaagcatgaagtcgcaaacaagaggtcatgaggtgaagaggctgttctggggaagtgttggcaatggagtgtcgaagattcaggttaaggcttcgcaaaaggatagtgaatttgtgaaattcaaggggcggttatcaaatccaattcttgtctatgaagtttcaggtagagatggaaaagaagtttgtggtggtttttttgtagataaggttttggaaatgctatcagtggaattgggcgagatttcacccttacaaaaagggcatggcattcgtgtggtgaatgtgggtcaatctcgtccaaagatgaacaatgagctttcatctgatccaagtatcgtagatcttgatattccattcagccttgtctttgcttgtggagctaccataaatgcttactccaatcttggaataatagctgctgttacatgcaaatctgatataaagagcataaaggtgaggctaggggtgattaagaagaagaggaacgctgtgctgaagtatctgaagaataatgttgctgttcttctcaagattggccttgatattaatgtatatggagggttaagtttcatggctcattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

251

Amino Acids

27.67

Weight (kDa)

8.65

Isoelectric Point (pI)

26.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000328)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g13832 FvH4_3g26701 FvH4_4g14350 FvH4_7g17370
malus_domestica MD12G1077900.v1.1 MD14G1070200.v1.1
prunus_persica Prupe.2G073100_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1 Prupe.2G186800_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0365191 RchiOBHm_Chr2g0105141 RchiOBHm_Chr2g0120431 RchiOBHm_Chr2g0139381 RchiOBHm_Chr3g0494421 RchiOBHm_Chr6g0248181 RchiOBHm_Chr7g0235571
rosa_laevigata RLG00000005158 RLG00000008937 RLG00000013742 RLG00000015899 RLG00000019885 RLG00000024515 RLG00000024516 RLG00000028740 RLG00000030656 RLG00000030662 RLG00000032758 RLG00000035668 RLG00000036717 RLG00000036718
rosa_multiflora Rmu_sc0000252.1_g000016 Rmu_sc0001386.1_g000020 Rmu_sc0002271.1_g000010 Rmu_sc0003833.1_g000002 Rmu_sc0004718.1_g000004 Rmu_sc0006031.1_g000006 Rmu_sc0006598.1_g000013 Rmu_sc0007472.1_g000023 Rmu_sc0009313.1_g000012
rosa_roxburghii Rroxscaffold_2G00103830 Rroxscaffold_2G00109880 Rroxscaffold_3G00225910 Rroxscaffold_3G00271600 Rroxscaffold_3G00274560 Rroxscaffold_4G00299580 Rroxscaffold_5G00352530 Rroxscaffold_5G00379280 Rroxscaffold_7G00177320
rosa_rugosa Rorug01G0027200 Rorug01G0032100 Rorug02G0050600 Rorug02G0054800 Rorug04G0083300 Rorug05G0115200 Rorug07G0006800
rosa_samantha Rh1CG086700 Rh1DG093300 Rh1DG217000 Rh2AG120200 Rh2AG227900 Rh2AG254000 Rh2AG434200 Rh2AG469200 Rh2BG159500 Rh2CG419900 Rh2CG455200 Rh2DG320100 Rh2DG603500 Rh3CG319900 Rh3DG300800 Rh3DG319200 Rh4AG199400 Rh4BG329100 Rh4BG329200 Rh4CG110800 Rh4DG042000 Rh4DG129400 Rh4DG187700 Rh4DG231900 Rh5AG038800 Rh5AG107300 Rh5AG303600 Rh5AG386500 Rh5AG454200 Rh5CG041800 Rh5CG534800 Rh5DG076400 Rh5DG109800 Rh5DG123600 Rh6AG164400 Rh6BG035100 Rh6BG036000 Rh6BG041000 Rh6BG215500 Rh6CG173900 Rh6CG174000 Rh6DG020300 Rh6DG166300 Rh6DG320000 Rh6DG509700 Rh7AG059500 Rh7AG291700 Rh7BG404300 Rh7DG402000
rosa_wichuraiana Rw1G000890 Rw1G020020 Rw3G005730 Rw4G011330 Rw4G026960 Rw5G014010 Rw6G002230 Rw7G038480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 301
AclI AACGTT 1 cut(s) 131
AclWI GGATC 1 cut(s) 494
AcsI RAATTY 2 cut(s) 281, 290
AcuI CTGAAG 2 cut(s) 689, 698
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 3 cut(s) 32, 127, 295
AluBI AGCT 4 cut(s) 149, 490, 554, 590
AluI AGCT 4 cut(s) 149, 490, 554, 590
Alw26I GTCTC 1 cut(s) 18
AlwI GGATC 1 cut(s) 494
AoxI GGCC 1 cut(s) 709
ApeKI GCWGC 1 cut(s) 590
ApoI RAATTY 2 cut(s) 281, 290
ArsI GACNNNNNNTTYG 2 cut(s) 181, 213
AseI ATTAAT 1 cut(s) 720
AsuHPI GGTGA 5 cut(s) 217, 411, 463, 640, 652
BbvI GCAGC 1 cut(s) 577
BccI CCATC 2 cut(s) 149, 338
BcgI CGANNNNNNTGC 2 cut(s) 425, 459
BcoDI GTCTC 1 cut(s) 18
BfaI CTAG 2 cut(s) 138, 635
BglII AGATCT 1 cut(s) 514
BisI GCNGC 1 cut(s) 591
BlsI GCNGC 1 cut(s) 592
BmsI GCATC 1 cut(s) 72
BpuEI CTTGAG 2 cut(s) 131, 686
BsaJI CCNNGG 1 cut(s) 168
BsaXI ACNNNNNCTCC 2 cut(s) 83, 113
Bsc4I CCNNNNNNNGG 1 cut(s) 115
Bse3DI GCAATG 1 cut(s) 241
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 10, 87
BseLI CCNNNNNNNGG 1 cut(s) 115
BseMI GCAATG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 111
BseXI GCAGC 1 cut(s) 577
BshFI GGCC 1 cut(s) 711
BslI CCNNNNNNNGG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 18
BsmI GAATGC 1 cut(s) 441
BsnI GGCC 1 cut(s) 711
Bsp143I GATC 2 cut(s) 499, 514
BspACI CCGC 1 cut(s) 301
BspANI GGCC 1 cut(s) 711
BspCNI CTCAG 1 cut(s) 112
BspHI TCATGA 1 cut(s) 199
BspPI GGATC 1 cut(s) 494
BsrDI GCAATG 1 cut(s) 241
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 2 cut(s) 499, 514
Bst6I CTCTTC 2 cut(s) 203, 647
BstDEI CTNAG 1 cut(s) 120
BstDSI CCRYGG 1 cut(s) 168
BstF5I GGATG 2 cut(s) 10, 87
BstKTI GATC 2 cut(s) 502, 517
BstMAI GTCTC 1 cut(s) 18
BstMBI GATC 2 cut(s) 499, 514
BstMWI GCNNNNNNNGC 1 cut(s) 551
BstNSI RCATGY 1 cut(s) 603
BstV1I GCAGC 1 cut(s) 577
BstX2I RGATCY 1 cut(s) 514
BstYI RGATCY 1 cut(s) 514
BsuRI GGCC 1 cut(s) 711
BtgI CCRYGG 1 cut(s) 168
BtsCI GGATG 2 cut(s) 10, 87
BtsIMutI CAGTG 1 cut(s) 405
CciI TCATGA 1 cut(s) 199
CviAII CATG 5 cut(s) 178, 200, 437, 600, 745
DdeI CTNAG 1 cut(s) 120
DpnI GATC 2 cut(s) 501, 516
DpnII GATC 2 cut(s) 499, 514
Eam1104I CTCTTC 2 cut(s) 203, 647
EarI CTCTTC 2 cut(s) 203, 647
Eco57I CTGAAG 2 cut(s) 689, 698
FaeI CATG 5 cut(s) 181, 203, 440, 603, 748
FatI CATG 5 cut(s) 177, 199, 436, 599, 744
Fnu4HI GCNGC 1 cut(s) 591
FokI GGATG 2 cut(s) 17, 94
Fsp4HI GCNGC 1 cut(s) 591
FspBI CTAG 2 cut(s) 138, 635
GluI GCNGC 1 cut(s) 591
HaeIII GGCC 1 cut(s) 711
Hin1II CATG 5 cut(s) 181, 203, 440, 603, 748
HinfI GANTC 1 cut(s) 250
HphI GGTGA 5 cut(s) 217, 411, 463, 640, 652
Hpy188I TCNGA 3 cut(s) 499, 610, 678
Hpy188III TCNNGA 3 cut(s) 200, 518, 703
HpyCH4IV ACGT 1 cut(s) 131
HpyCH4V TGCA 2 cut(s) 96, 603
HpyF10VI GCNNNNNNNGC 1 cut(s) 551
HpyF3I CTNAG 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 131
Hsp92II CATG 5 cut(s) 181, 203, 440, 603, 748
Kzo9I GATC 2 cut(s) 499, 514
LmnI GCTCC 1 cut(s) 551
LpnPI CCDG 3 cut(s) 205, 239, 321
Lsp1109I GCAGC 1 cut(s) 577
LweI GCATC 1 cut(s) 72
MaeI CTAG 2 cut(s) 138, 635
MaeII ACGT 1 cut(s) 131
MaeIII GTNAC 2 cut(s) 104, 595
MalI GATC 2 cut(s) 501, 516
MboI GATC 2 cut(s) 499, 514
MboII GAAGA 6 cut(s) 220, 259, 661, 664, 689, 691
MfeI CAATTG 1 cut(s) 32
MflI RGATCY 1 cut(s) 514
MluCI AATT 6 cut(s) 32, 59, 281, 290, 315, 404
MnlI CCTC 7 cut(s) 45, 188, 196, 204, 624, 648, 725
MseI TTAA 4 cut(s) 258, 645, 720, 737
MslI CAYNNNNRTG 2 cut(s) 446, 626
MunI CAATTG 1 cut(s) 32
Mva1269I GAATGC 1 cut(s) 441
MwoI GCNNNNNNNGC 1 cut(s) 551
NdeII GATC 2 cut(s) 499, 514
NlaIII CATG 5 cut(s) 181, 203, 440, 603, 748
NmuCI GTSAC 1 cut(s) 104
NspI RCATGY 1 cut(s) 603
PagI TCATGA 1 cut(s) 199
PctI GAATGC 1 cut(s) 441
PfeI GAWTC 1 cut(s) 250
PkrI GCNGC 1 cut(s) 592
PshBI ATTAAT 1 cut(s) 720
Psp1406I AACGTT 1 cut(s) 131
PsuI RGATCY 1 cut(s) 514
RseI CAYNNNNRTG 2 cut(s) 446, 626
SaqAI TTAA 4 cut(s) 258, 645, 720, 737
SatI GCNGC 1 cut(s) 591
Sau3AI GATC 2 cut(s) 499, 514
SfaNI GCATC 1 cut(s) 72
SmiMI CAYNNNNRTG 2 cut(s) 446, 626
SmlI CTYRAG 2 cut(s) 110, 701
SmoI CTYRAG 2 cut(s) 110, 701
Sse9I AATT 6 cut(s) 32, 59, 281, 290, 315, 404
SsiI CCGC 1 cut(s) 301
SspMI CTAG 2 cut(s) 138, 635
TaiI ACGT 1 cut(s) 134
TaqI TCGA 1 cut(s) 245
TasI AATT 6 cut(s) 32, 59, 281, 290, 315, 404
TfiI GAWTC 1 cut(s) 250
Tru1I TTAA 4 cut(s) 258, 645, 720, 737
Tru9I TTAA 4 cut(s) 258, 645, 720, 737
TscAI CASTG 1 cut(s) 405
TseFI GTSAC 1 cut(s) 104
TseI GCWGC 1 cut(s) 590
Tsp45I GTSAC 1 cut(s) 104
TspDTI ATGAA 6 cut(s) 72, 194, 342, 483, 494, 733
TspGWI ACGGA 1 cut(s) 157
TspRI CASTG 1 cut(s) 405
VspI ATTAAT 1 cut(s) 720
XapI RAATTY 2 cut(s) 281, 290
XceI RCATGY 1 cut(s) 603
XspI CTAG 2 cut(s) 138, 635
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.