RLG00000000512

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0000695
Physical Location & Seq
Forward (+)
1308920 .. 1309314
395 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000512

Sequence Viewer

Length: 321 bp
ATGAGGGTGGAAGCAAAACTATATGGGACAACCATTCCCATTGGGTCCCCTCCGGTAGGTCACCTTACCAAGGACCTTGGTTCTGGACAAGGTAGTTGCTCCAACTTGAAAGAGAAGACCACAAAGCAAAAGCTGAGGAGGGGGTTACCGGTAGAAGTGGAAGCTGGTATAGAAGTAGCAGCTACTATAGAAGTGGCAGCTGCTATAGAAGTGGCAGCTGCTATAGAGCATGTTCATGCCGCTCCTACAGAGGTTCGTGTTGCTCTTATTAAGTCGGTTGAAGTTACACAGGAGGTAGATGTGAACTGCTTGACTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.08

Weight (kDa)

5.89

Isoelectric Point (pI)

45.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 242
AciI CCGC 1 cut(s) 240
AfiI CCNNNNNNNGG 2 cut(s) 56, 70
AgeI ACCGGT 1 cut(s) 148
AgsI TTSAA 2 cut(s) 109, 281
AluBI AGCT 5 cut(s) 133, 164, 182, 200, 218
AluI AGCT 5 cut(s) 133, 164, 182, 200, 218
ApeKI GCWGC 5 cut(s) 179, 197, 200, 215, 218
AsiGI ACCGGT 1 cut(s) 148
AspS9I GGNCC 2 cut(s) 45, 73
AsuHPI GGTGA 1 cut(s) 53
AvaII GGWCC 2 cut(s) 45, 73
BbsI GAAGAC 1 cut(s) 122
BbvCI CCTCAGC 1 cut(s) 134
BbvI GCAGC 5 cut(s) 187, 191, 205, 209, 227
BfmI CTRYAG 4 cut(s) 186, 204, 222, 246
BisI GCNGC 6 cut(s) 180, 198, 201, 216, 219, 240
BlsI GCNGC 6 cut(s) 181, 199, 202, 217, 220, 241
Bme18I GGWCC 2 cut(s) 45, 73
BmgT120I GGNCC 2 cut(s) 45, 73
BmiI GGNNCC 2 cut(s) 46, 47
BpiI GAAGAC 1 cut(s) 122
Bpu10I CCTNAGC 1 cut(s) 134
BsaJI CCNNGG 2 cut(s) 69, 76
BsaWI WCCGGW 2 cut(s) 52, 148
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 70
Bse118I RCCGGY 1 cut(s) 148
BseDI CCNNGG 2 cut(s) 69, 76
BseLI CCNNNNNNNGG 2 cut(s) 56, 70
BseMII CTCAG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 151
BseXI GCAGC 5 cut(s) 187, 191, 205, 209, 227
BshTI ACCGGT 1 cut(s) 148
BsiSI CCGG 2 cut(s) 53, 149
BslFI GGGAC 2 cut(s) 31, 40
BslI CCNNNNNNNGG 2 cut(s) 56, 70
BsmFI GGGAC 2 cut(s) 31, 40
BspACI CCGC 1 cut(s) 240
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 2 cut(s) 46, 47
BsrBI CCGCTC 1 cut(s) 242
BsrFI RCCGGY 1 cut(s) 148
BssAI RCCGGY 1 cut(s) 148
BssECI CCNNGG 2 cut(s) 69, 76
BssT1I CCWWGG 2 cut(s) 69, 76
BstDEI CTNAG 1 cut(s) 134
BstEII GGTNACC 2 cut(s) 59, 144
BstENI CCTNNNNNAGG 2 cut(s) 54, 68
BstNSI RCATGY 1 cut(s) 233
BstPI GGTNACC 2 cut(s) 59, 144
BstSFI CTRYAG 4 cut(s) 186, 204, 222, 246
BstV1I GCAGC 5 cut(s) 187, 191, 205, 209, 227
BstV2I GAAGAC 1 cut(s) 122
Cfr10I RCCGGY 1 cut(s) 148
Cfr13I GGNCC 2 cut(s) 45, 73
CspAI ACCGGT 1 cut(s) 148
CviAII CATG 2 cut(s) 230, 236
CviJI RGCY 5 cut(s) 133, 164, 182, 200, 218
CviKI_1 RGCY 5 cut(s) 133, 164, 182, 200, 218
DdeI CTNAG 1 cut(s) 134
Eco130I CCWWGG 2 cut(s) 69, 76
Eco47I GGWCC 2 cut(s) 45, 73
Eco91I GGTNACC 2 cut(s) 59, 144
EcoNI CCTNNNNNAGG 2 cut(s) 54, 68
EcoO109I RGGNCCY 2 cut(s) 45, 73
EcoO65I GGTNACC 2 cut(s) 59, 144
EcoT14I CCWWGG 2 cut(s) 69, 76
ErhI CCWWGG 2 cut(s) 69, 76
FaeI CATG 2 cut(s) 233, 239
FaiI YATR 9 cut(s) 22, 24, 170, 188, 206, 224, 231, 237, 319
FaqI GGGAC 2 cut(s) 31, 40
FatI CATG 2 cut(s) 229, 235
Fnu4HI GCNGC 6 cut(s) 180, 198, 201, 216, 219, 240
Fsp4HI GCNGC 6 cut(s) 180, 198, 201, 216, 219, 240
GluI GCNGC 6 cut(s) 180, 198, 201, 216, 219, 240
HapII CCGG 2 cut(s) 53, 149
Hin1II CATG 2 cut(s) 233, 239
HpaII CCGG 2 cut(s) 53, 149
HphI GGTGA 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 304
Hpy188III TCNNGA 1 cut(s) 84
Hpy8I GTNNAC 1 cut(s) 304
HpyCH4V TGCA 1 cut(s) 317
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 2 cut(s) 233, 239
KflI GGGWCCC 1 cut(s) 45
LmnI GCTCC 2 cut(s) 104, 247
LpnPI CCDG 5 cut(s) 66, 69, 150, 162, 275
Lsp1109I GCAGC 5 cut(s) 187, 191, 205, 209, 227
MaeIII GTNAC 3 cut(s) 59, 144, 283
MbiI CCGCTC 1 cut(s) 242
MboII GAAGA 1 cut(s) 127
MmeI TCCRAC 1 cut(s) 126
MnlI CCTC 5 cut(s) 60, 129, 132, 244, 286
MseI TTAA 1 cut(s) 270
MslI CAYNNNNRTG 1 cut(s) 234
MspA1I CMGCKG 2 cut(s) 200, 218
MspI CCGG 2 cut(s) 53, 149
NlaIII CATG 2 cut(s) 233, 239
NlaIV GGNNCC 2 cut(s) 46, 47
NmuCI GTSAC 1 cut(s) 59
NspI RCATGY 1 cut(s) 233
PinAI ACCGGT 1 cut(s) 148
PkrI GCNGC 6 cut(s) 181, 199, 202, 217, 220, 241
PpuMI RGGWCCY 2 cut(s) 45, 73
Psp5II RGGWCCY 2 cut(s) 45, 73
PspEI GGTNACC 2 cut(s) 59, 144
PspN4I GGNNCC 2 cut(s) 46, 47
PspPI GGNCC 2 cut(s) 45, 73
PspPPI RGGWCCY 2 cut(s) 45, 73
PvuII CAGCTG 2 cut(s) 200, 218
RseI CAYNNNNRTG 1 cut(s) 234
SaqAI TTAA 1 cut(s) 270
SatI GCNGC 6 cut(s) 180, 198, 201, 216, 219, 240
Sau96I GGNCC 2 cut(s) 45, 73
SfcI CTRYAG 4 cut(s) 186, 204, 222, 246
SinI GGWCC 2 cut(s) 45, 73
SmiMI CAYNNNNRTG 1 cut(s) 234
SsiI CCGC 1 cut(s) 240
StyI CCWWGG 2 cut(s) 69, 76
TauI GCSGC 1 cut(s) 242
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
TseFI GTSAC 1 cut(s) 59
TseI GCWGC 5 cut(s) 179, 197, 200, 215, 218
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 224
VpaK11BI GGWCC 2 cut(s) 45, 73
XagI CCTNNNNNAGG 2 cut(s) 54, 68
XceI RCATGY 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.