Rh7CG476300

Domain of unknown function (DUF2828)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000695
Physical Location & Seq
Forward (+)
63940716 .. 63949535
8820 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG476300.1

Sequence Viewer

Length: 450 bp
ATGAAGAGGAGTTATATATTTATCGACTTCAAGAAGCTGCCGAAAGATTACCCTGCAGCGTGCAAGTGCTTGTGGTTGTGGGCGAAAGACAATTTGGCAAATGGGAAGACAATCTCCTTTCAGATGGAAGACAAAGTTTTTGGCATCAACAAAAAGCAATATGTGTTTAAGGGAGATATTCATGCCTTGTGTACCATGGGTGAATTGTCGGGTGGAGTGATCTGCATGTACATGCTTGGTATCAAAATTTACAATGCTCACAGGAATAGATCTAGCCGCAAATCAATATTCTGGCAAACCATGGCGGATTCAAAATTGACGTCGGTGATGGCAACAGAACTGGGGGTGGCGTTGTTGAGCGGCTTCTCCAAGAATCCGCTCAAGATATTCTTGGATGGTGATATATGGCCCAATTTTGTCGGACCTTATCATGAAAAAAGCTATCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2828

Protein Analysis

149

Amino Acids

17.04

Weight (kDa)

9.43

Isoelectric Point (pI)

37.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7788 PF25043 96 - 134 1.8e-06 Domain of unknown function (DUF7788)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 323
AccBSI CCGCTC 2 cut(s) 360, 379
AciI CCGC 4 cut(s) 277, 305, 360, 377
AcsI RAATTY 1 cut(s) 246
AcyI GRCGYC 1 cut(s) 320
AfaI GTAC 2 cut(s) 193, 230
AgsI TTSAA 2 cut(s) 31, 312
AjuI GAANNNNNNNTTGG 2 cut(s) 77, 109
AluBI AGCT 2 cut(s) 37, 441
AluI AGCT 2 cut(s) 37, 441
AoxI GGCC 1 cut(s) 407
ApeKI GCWGC 2 cut(s) 37, 56
ApoI RAATTY 1 cut(s) 246
ArsI GACNNNNNNTTYG 4 cut(s) 122, 154, 305, 337
AspS9I GGNCC 2 cut(s) 408, 422
AsuHPI GGTGA 3 cut(s) 212, 337, 410
AvaII GGWCC 1 cut(s) 422
BbsI GAAGAC 2 cut(s) 113, 135
BbvI GCAGC 2 cut(s) 24, 68
BccI CCATC 3 cut(s) 118, 322, 389
BfaI CTAG 2 cut(s) 273, 448
BfmI CTRYAG 1 cut(s) 54
BglII AGATCT 1 cut(s) 269
BisI GCNGC 4 cut(s) 38, 57, 277, 361
BlsI GCNGC 4 cut(s) 39, 58, 278, 362
Bme18I GGWCC 1 cut(s) 422
BmgT120I GGNCC 2 cut(s) 408, 422
BmrI ACTGGG 1 cut(s) 350
BmsI GCATC 1 cut(s) 153
BmuI ACTGGG 1 cut(s) 350
BpiI GAAGAC 2 cut(s) 113, 135
BpuEI CTTGAG 1 cut(s) 365
BsaHI GRCGYC 1 cut(s) 320
BsaJI CCNNGG 2 cut(s) 195, 300
Bse1I ACTGG 1 cut(s) 345
BseDI CCNNGG 2 cut(s) 195, 300
BseGI GGATG 1 cut(s) 400
BseNI ACTGG 1 cut(s) 345
BseRI GAGGAG 1 cut(s) 22
BseXI GCAGC 2 cut(s) 24, 68
BshFI GGCC 1 cut(s) 409
BsnI GGCC 1 cut(s) 409
Bsp1407I TGTACA 1 cut(s) 228
Bsp143I GATC 2 cut(s) 219, 269
Bsp19I CCATGG 2 cut(s) 195, 300
BspACI CCGC 4 cut(s) 277, 305, 360, 377
BspANI GGCC 1 cut(s) 409
BspHI TCATGA 1 cut(s) 430
BspMAI CTGCAG 1 cut(s) 58
BsrBI CCGCTC 2 cut(s) 360, 379
BsrGI TGTACA 1 cut(s) 228
BsrI ACTGG 1 cut(s) 345
BssECI CCNNGG 2 cut(s) 195, 300
BssMI GATC 2 cut(s) 219, 269
BssNI GRCGYC 1 cut(s) 320
BssT1I CCWWGG 2 cut(s) 195, 300
BstACI GRCGYC 1 cut(s) 320
BstAUI TGTACA 1 cut(s) 228
BstC8I GCNNGC 1 cut(s) 61
BstDSI CCRYGG 2 cut(s) 195, 300
BstF5I GGATG 1 cut(s) 400
BstKTI GATC 2 cut(s) 222, 272
BstMBI GATC 2 cut(s) 219, 269
BstNSI RCATGY 2 cut(s) 229, 235
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 2 cut(s) 24, 68
BstV2I GAAGAC 2 cut(s) 113, 135
BstX2I RGATCY 1 cut(s) 269
BstYI RGATCY 1 cut(s) 269
BsuRI GGCC 1 cut(s) 409
BtgI CCRYGG 2 cut(s) 195, 300
BtsCI GGATG 1 cut(s) 400
Cac8I GCNNGC 1 cut(s) 61
CciI TCATGA 1 cut(s) 430
Cfr13I GGNCC 2 cut(s) 408, 422
Csp6I GTAC 2 cut(s) 192, 229
CviAII CATG 6 cut(s) 182, 196, 226, 232, 301, 431
CviJI RGCY 5 cut(s) 37, 276, 363, 409, 441
CviKI_1 RGCY 5 cut(s) 37, 276, 363, 409, 441
CviQI GTAC 2 cut(s) 192, 229
DpnI GATC 2 cut(s) 221, 271
DpnII GATC 2 cut(s) 219, 269
EciI GGCGGA 1 cut(s) 320
Eco130I CCWWGG 2 cut(s) 195, 300
Eco47I GGWCC 1 cut(s) 422
EcoT14I CCWWGG 2 cut(s) 195, 300
ErhI CCWWGG 2 cut(s) 195, 300
FaeI CATG 6 cut(s) 185, 199, 229, 235, 304, 434
FalI AAGNNNNNCTT 2 cut(s) 374, 406
FatI CATG 6 cut(s) 181, 195, 225, 231, 300, 430
Fnu4HI GCNGC 4 cut(s) 38, 57, 277, 361
FokI GGATG 1 cut(s) 407
Fsp4HI GCNGC 4 cut(s) 38, 57, 277, 361
FspBI CTAG 2 cut(s) 273, 448
GluI GCNGC 4 cut(s) 38, 57, 277, 361
HaeIII GGCC 1 cut(s) 409
Hin1I GRCGYC 1 cut(s) 320
Hin1II CATG 6 cut(s) 185, 199, 229, 235, 304, 434
HinfI GANTC 2 cut(s) 308, 373
HphI GGTGA 3 cut(s) 212, 337, 410
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 2 cut(s) 123, 422
Hpy188III TCNNGA 3 cut(s) 31, 382, 431
Hpy8I GTNNAC 1 cut(s) 192
Hpy99I CGWCG 1 cut(s) 325
HpyCH4IV ACGT 1 cut(s) 320
HpyCH4V TGCA 3 cut(s) 56, 63, 225
HpySE526I ACGT 1 cut(s) 320
Hsp92I GRCGYC 1 cut(s) 320
Hsp92II CATG 6 cut(s) 185, 199, 229, 235, 304, 434
Kzo9I GATC 2 cut(s) 219, 269
LpnPI CCDG 4 cut(s) 66, 247, 277, 326
Lsp1109I GCAGC 2 cut(s) 24, 68
LweI GCATC 1 cut(s) 153
MaeI CTAG 2 cut(s) 273, 448
MaeII ACGT 1 cut(s) 320
MalI GATC 2 cut(s) 221, 271
MbiI CCGCTC 2 cut(s) 360, 379
MboI GATC 2 cut(s) 219, 269
MboII GAAGA 3 cut(s) 16, 118, 140
MflI RGATCY 1 cut(s) 269
MluCI AATT 5 cut(s) 91, 203, 246, 314, 412
MmeI TCCRAC 1 cut(s) 400
MseI TTAA 1 cut(s) 168
MslI CAYNNNNRTG 1 cut(s) 230
NcoI CCATGG 2 cut(s) 195, 300
NdeII GATC 2 cut(s) 219, 269
NlaIII CATG 6 cut(s) 185, 199, 229, 235, 304, 434
NspI RCATGY 2 cut(s) 229, 235
PagI TCATGA 1 cut(s) 430
PfeI GAWTC 2 cut(s) 308, 373
PkrI GCNGC 4 cut(s) 39, 58, 278, 362
PspPI GGNCC 2 cut(s) 408, 422
PstI CTGCAG 1 cut(s) 58
PsuI RGATCY 1 cut(s) 269
RsaI GTAC 2 cut(s) 193, 230
RsaNI GTAC 2 cut(s) 192, 229
RseI CAYNNNNRTG 1 cut(s) 230
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 4 cut(s) 38, 57, 277, 361
Sau3AI GATC 2 cut(s) 219, 269
Sau96I GGNCC 2 cut(s) 408, 422
SetI ASST 4 cut(s) 39, 323, 427, 443
SfaNI GCATC 1 cut(s) 153
SfcI CTRYAG 1 cut(s) 54
SinI GGWCC 1 cut(s) 422
SmiMI CAYNNNNRTG 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 380
SmoI CTYRAG 1 cut(s) 380
Sse9I AATT 5 cut(s) 91, 203, 246, 314, 412
SsiI CCGC 4 cut(s) 277, 305, 360, 377
SspI AATATT 1 cut(s) 288
SspMI CTAG 2 cut(s) 273, 448
StyI CCWWGG 2 cut(s) 195, 300
TaiI ACGT 1 cut(s) 323
TaqI TCGA 1 cut(s) 24
TasI AATT 5 cut(s) 91, 203, 246, 314, 412
TatI WGTACW 1 cut(s) 228
TauI GCSGC 2 cut(s) 279, 363
TfiI GAWTC 2 cut(s) 308, 373
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 2 cut(s) 37, 56
TspDTI ATGAA 3 cut(s) 17, 170, 447
VpaK11BI GGWCC 1 cut(s) 422
XapI RAATTY 1 cut(s) 246
XceI RCATGY 2 cut(s) 229, 235
XspI CTAG 2 cut(s) 273, 448
ZraI GACGTC 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.