Rh7BG412300

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
46469422 .. 46479148
9727 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG412300.1

Sequence Viewer

Length: 342 bp
ATGAAGAAACAGCAAAATAAGTCCAGTAAGGGTTTAAAAAAGAGGAAAAGGCAAGTAGATAATCCTGAAGAGGAGTATATTGACATGAAGAAGCTACCAAAAGATTACCCTGCACCTTTGAAGTGCTTGTGGATTTGGGCGAGAGACAATATGGCAAATGGGAAGACAATCTCCTTCAAGTTGGAAGAGAATGTGTTTGGCATCGAAAGGAAGCAATATCTGTTTAAGTCAGACATTCATGCATTGTGTATGATGACTGAACTATCAGGTGGTGTAATCTGCATGTATATATGCATCGAGGCAGAGCATCCTACAGGGATGGACTGCAAATGGAGAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

13.23

Weight (kDa)

9.1

Isoelectric Point (pI)

51.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 87
AgsI TTSAA 2 cut(s) 121, 178
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw26I GTCTC 1 cut(s) 138
BbsI GAAGAC 1 cut(s) 170
BccI CCATC 1 cut(s) 313
BcoDI GTCTC 1 cut(s) 138
BfmI CTRYAG 1 cut(s) 312
BmsI GCATC 3 cut(s) 210, 303, 316
BpiI GAAGAC 1 cut(s) 170
Bse1I ACTGG 1 cut(s) 24
BseGI GGATG 2 cut(s) 307, 324
BseNI ACTGG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 86
BsgI GTGCAG 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 24
Bst6I CTCTTC 2 cut(s) 63, 180
BstF5I GGATG 2 cut(s) 307, 324
BstMAI GTCTC 1 cut(s) 138
BstNSI RCATGY 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 312
BstV2I GAAGAC 1 cut(s) 170
BtsCI GGATG 2 cut(s) 307, 324
CviAII CATG 3 cut(s) 85, 239, 283
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
DraI TTTAAA 1 cut(s) 36
Eam1104I CTCTTC 2 cut(s) 63, 180
EarI CTCTTC 2 cut(s) 63, 180
Eco57I CTGAAG 1 cut(s) 87
EcoT22I ATGCAT 2 cut(s) 244, 296
FaeI CATG 3 cut(s) 88, 242, 286
FaiI YATR 9 cut(s) 78, 86, 152, 240, 251, 284, 288, 290, 292
FatI CATG 3 cut(s) 84, 238, 282
FokI GGATG 2 cut(s) 294, 331
Hin1II CATG 3 cut(s) 88, 242, 286
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 184
HpyCH4V TGCA 5 cut(s) 113, 242, 282, 294, 327
Hsp92II CATG 3 cut(s) 88, 242, 286
LpnPI CCDG 5 cut(s) 37, 78, 123, 252, 300
LweI GCATC 3 cut(s) 210, 303, 316
MboII GAAGA 5 cut(s) 16, 80, 100, 175, 197
MmeI TCCRAC 1 cut(s) 162
MnlI CCTC 4 cut(s) 36, 64, 292, 329
Mph1103I ATGCAT 2 cut(s) 244, 296
MseI TTAA 2 cut(s) 35, 225
NlaIII CATG 3 cut(s) 88, 242, 286
NsiI ATGCAT 2 cut(s) 244, 296
NspI RCATGY 1 cut(s) 286
SaqAI TTAA 2 cut(s) 35, 225
SetI ASST 3 cut(s) 96, 118, 271
SfaNI GCATC 3 cut(s) 210, 303, 316
SfcI CTRYAG 1 cut(s) 312
TaqI TCGA 2 cut(s) 204, 297
Tru1I TTAA 2 cut(s) 35, 225
Tru9I TTAA 2 cut(s) 35, 225
TspDTI ATGAA 3 cut(s) 17, 101, 227
XceI RCATGY 1 cut(s) 286
Zsp2I ATGCAT 2 cut(s) 244, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.