Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4C

Orthogroup ID

OG0000695

Physical Location & Seq

Genomic Coordinates Reverse (-)

39136522 .. 39136704

Gene Structure 183 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4CG180400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

ATGGAAGAGGATGGTGTGGTGGGTGGTTGTGTTGGCATTAAGGTGTTTGTGGAAATGGCACAAGATGTGGAAGTTCTGGGTTTTGATGTAGAAATGGCACAAGGTGTGGAAGTTCTAGGATTTGATGCAAAAGGAAAAGCCAATCGAAACATGGTGTTGATCAAGAAGAGGTGGAAGTTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

60

Amino Acids

6.62

Weight (kDa)

4.93

Isoelectric Point (pI)

36.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000695)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0405551
rosa_laevigata	RLG00000000512 RLG00000006283 RLG00000008110 RLG00000008280 RLG00000013435 RLG00000014038 RLG00000019487 RLG00000019783 RLG00000020425 RLG00000022555 RLG00000022693 RLG00000023047 RLG00000027683 RLG00000028941 RLG00000029255 RLG00000033981 RLG00000034375 RLG00000035055 RLG00000036983
rosa_multiflora	Rmu_sc0002070.1_g000038 Rmu_sc0002521.1_g000050 Rmu_sc0002986.1_g000060 Rmu_sc0003002.1_g000067 Rmu_sc0006244.1_g000030 Rmu_sc0009710.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002410 Rroxscaffold_1G00026380 Rroxscaffold_1G00026390 Rroxscaffold_1G00063340 Rroxscaffold_2G00089150 Rroxscaffold_2G00114500 Rroxscaffold_2G00155770 Rroxscaffold_3G00224480 Rroxscaffold_3G00243690 Rroxscaffold_3G00251260 Rroxscaffold_4G00298200 Rroxscaffold_4G00327440 Rroxscaffold_7G00192530
rosa_rugosa	Rorug01G0052300 Rorug01G0094500 Rorug03G0152700 Rorug03G0245200 Rorug03G0338800 Rorug03G0338900 Rorug04G0045100 Rorug04G0168400 Rorug04G0291600 Rorug07G0163300 Rorug07G0349700
rosa_samantha	Rh1AG146400 Rh1BG098400 Rh2CG327400 Rh3BG286300 Rh3BG323300 Rh4AG085300 Rh4AG137800 Rh4CG008600 Rh4CG032900 Rh4CG092500 Rh4CG180400 Rh4CG231200 Rh4CG274400 Rh4CG304800 Rh5AG384900 Rh5BG344700 Rh5CG355300 Rh6AG151000 Rh6BG302500 Rh6DG135900 Rh6DG138700 Rh6DG206300 Rh6DG319500 Rh7BG412300 Rh7CG476300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AdeI	CACNNNGTG	1 cut(s)	104
BccI	CCATC	1 cut(s)	5
BclI	TGATCA	1 cut(s)	159
BfaI	CTAG	2 cut(s)	116, 181
BmsI	GCATC	1 cut(s)	115
BseGI	GGATG	1 cut(s)	16
Bsp143I	GATC	1 cut(s)	159
BssMI	GATC	1 cut(s)	159
Bst6I	CTCTTC	1 cut(s)	161
BstF5I	GGATG	1 cut(s)	16
BstKTI	GATC	1 cut(s)	162
BstMBI	GATC	1 cut(s)	159
BtsCI	GGATG	1 cut(s)	16
CviAII	CATG	1 cut(s)	151
CviJI	RGCY	1 cut(s)	140
CviKI_1	RGCY	1 cut(s)	140
DpnI	GATC	1 cut(s)	161
DpnII	GATC	1 cut(s)	159
DraIII	CACNNNGTG	1 cut(s)	104
Eam1104I	CTCTTC	1 cut(s)	161
EarI	CTCTTC	1 cut(s)	161
FaeI	CATG	1 cut(s)	154
FaiI	YATR	1 cut(s)	152
FatI	CATG	1 cut(s)	150
FbaI	TGATCA	1 cut(s)	159
FokI	GGATG	1 cut(s)	23
FspBI	CTAG	2 cut(s)	116, 181
Hin1II	CATG	1 cut(s)	154
Hpy188III	TCNNGA	1 cut(s)	163
HpyCH4V	TGCA	1 cut(s)	128
Hsp92II	CATG	1 cut(s)	154
Ksp22I	TGATCA	1 cut(s)	159
Kzo9I	GATC	1 cut(s)	159
LpnPI	CCDG	1 cut(s)	62
LweI	GCATC	1 cut(s)	115
MaeI	CTAG	2 cut(s)	116, 181
MalI	GATC	1 cut(s)	161
MboI	GATC	1 cut(s)	159
MboII	GAAGA	2 cut(s)	17, 178
MnlI	CCTC	1 cut(s)	162
MseI	TTAA	1 cut(s)	39
MslI	CAYNNNNRTG	1 cut(s)	41
NdeII	GATC	1 cut(s)	159
NlaIII	CATG	1 cut(s)	154
RseI	CAYNNNNRTG	1 cut(s)	41
SaqAI	TTAA	1 cut(s)	39
Sau3AI	GATC	1 cut(s)	159
SetI	ASST	3 cut(s)	45, 106, 173
SfaNI	GCATC	1 cut(s)	115
SgeI	CNNG	6 cut(s)	74, 89, 113, 128, 163, 175
SmiMI	CAYNNNNRTG	1 cut(s)	41
SspMI	CTAG	2 cut(s)	116, 181
TaqI	TCGA	1 cut(s)	145
Tru1I	TTAA	1 cut(s)	39
Tru9I	TTAA	1 cut(s)	39
XcmI	CCANNNNNNNNNTGG	1 cut(s)	148
XspI	CTAG	2 cut(s)	116, 181

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.