Rh5BG344700

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
52533959 .. 52548225
14267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG344700.1

Sequence Viewer

Length: 354 bp
ATGAAACAACGGCCTAAGTCTGTTAAAGGTCTAAAGAAAAGGAAAAGGCCAGTAGAGGAGGATGAAGATGAGGATCTCGACTTGAAGAAACTGCCAAAAGATTACCCTGCACCGTTGAAATGCTTGTGGTTGTGGGCTAGAGACAATTTGGCAAATGGGAGGACAATGTCCTTTCAGATGGAAGATAAAGTTTTTGGCATCAACAGGAAGCATTATTTGTTTAAGGGAGACATTTATGCATTGTGTACCATGTCTGAACTATCTGGTGGAGTGATCTCCATGTATATTCTGTATGGGCTTGATTTAACTCTCTTTCACTTGGCTCACCAGTATATAAAACGGTCAGTTCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.69

Weight (kDa)

9.34

Isoelectric Point (pI)

61.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 81
AfaI GTAC 1 cut(s) 247
AgsI TTSAA 2 cut(s) 85, 118
Alw26I GTCTC 2 cut(s) 135, 222
AlwI GGATC 1 cut(s) 81
AoxI GGCC 2 cut(s) 11, 47
AsuHPI GGTGA 1 cut(s) 317
BccI CCATC 1 cut(s) 172
BceAI ACGGC 1 cut(s) 26
BcoDI GTCTC 2 cut(s) 135, 222
BfaI CTAG 1 cut(s) 138
BmsI GCATC 1 cut(s) 207
BsaBI GATNNNNATC 1 cut(s) 72
Bse1I ACTGG 2 cut(s) 50, 328
Bse8I GATNNNNATC 1 cut(s) 72
BseGI GGATG 1 cut(s) 67
BseJI GATNNNNATC 1 cut(s) 72
BseNI ACTGG 2 cut(s) 50, 328
BseRI GAGGAG 1 cut(s) 71
BsgI GTGCAG 1 cut(s) 93
BshFI GGCC 2 cut(s) 13, 49
BsmAI GTCTC 2 cut(s) 135, 222
BsnI GGCC 2 cut(s) 13, 49
Bsp143I GATC 2 cut(s) 73, 273
BspANI GGCC 2 cut(s) 13, 49
BspPI GGATC 1 cut(s) 81
BsrI ACTGG 2 cut(s) 50, 328
BssMI GATC 2 cut(s) 73, 273
Bst4CI ACNGT 2 cut(s) 114, 342
BstDEI CTNAG 1 cut(s) 15
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 2 cut(s) 76, 276
BstMAI GTCTC 2 cut(s) 135, 222
BstMBI GATC 2 cut(s) 73, 273
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BsuRI GGCC 2 cut(s) 13, 49
BtsCI GGATG 1 cut(s) 67
Csp6I GTAC 1 cut(s) 246
CviAII CATG 2 cut(s) 250, 280
CviJI RGCY 5 cut(s) 13, 49, 137, 298, 323
CviKI_1 RGCY 5 cut(s) 13, 49, 137, 298, 323
CviQI GTAC 1 cut(s) 246
DdeI CTNAG 1 cut(s) 15
DpnI GATC 2 cut(s) 75, 275
DpnII GATC 2 cut(s) 73, 273
EcoT22I ATGCAT 1 cut(s) 241
FaeI CATG 2 cut(s) 253, 283
FaiI YATR 8 cut(s) 237, 251, 281, 285, 294, 333, 335, 352
FatI CATG 2 cut(s) 249, 279
FokI GGATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 138
HaeIII GGCC 2 cut(s) 13, 49
Hin1II CATG 2 cut(s) 253, 283
HphI GGTGA 1 cut(s) 317
Hpy166II GTNNAC 1 cut(s) 246
Hpy188I TCNGA 2 cut(s) 177, 256
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 1 cut(s) 246
HpyCH4III ACNGT 2 cut(s) 114, 342
HpyCH4V TGCA 2 cut(s) 110, 239
HpyF3I CTNAG 1 cut(s) 15
Hsp92II CATG 2 cut(s) 253, 283
Kzo9I GATC 2 cut(s) 73, 273
LpnPI CCDG 5 cut(s) 63, 120, 190, 249, 341
LweI GCATC 1 cut(s) 207
MaeI CTAG 1 cut(s) 138
MalI GATC 2 cut(s) 75, 275
MboI GATC 2 cut(s) 73, 273
MboII GAAGA 3 cut(s) 77, 97, 194
MflI RGATCY 1 cut(s) 73
MluCI AATT 1 cut(s) 145
MnlI CCTC 4 cut(s) 49, 52, 64, 153
Mph1103I ATGCAT 1 cut(s) 241
MseI TTAA 3 cut(s) 24, 222, 305
NdeII GATC 2 cut(s) 73, 273
NlaIII CATG 2 cut(s) 253, 283
NsiI ATGCAT 1 cut(s) 241
PflFI GACNNNGTC 1 cut(s) 166
PsuI RGATCY 1 cut(s) 73
PsyI GACNNNGTC 1 cut(s) 166
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
SaqAI TTAA 3 cut(s) 24, 222, 305
Sau3AI GATC 2 cut(s) 73, 273
SetI ASST 1 cut(s) 31
SfaNI GCATC 1 cut(s) 207
Sse9I AATT 1 cut(s) 145
SspMI CTAG 1 cut(s) 138
TaaI ACNGT 2 cut(s) 114, 342
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 145
Tru1I TTAA 3 cut(s) 24, 222, 305
Tru9I TTAA 3 cut(s) 24, 222, 305
TspDTI ATGAA 2 cut(s) 17, 78
Tth111I GACNNNGTC 1 cut(s) 166
XspI CTAG 1 cut(s) 138
Zsp2I ATGCAT 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.