RLG00000028839

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
29048330 .. 29050206
1877 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000028839

Sequence Viewer

Length: 483 bp
ATGTCGGTGTCGACAAAGTCGAAGAAGAAGTTACGAGGCTCTATAGGGTTCGAAAAGACAGTGATGCAAATGCTGAAAGGTCAGGACTATCTAATTGTTGATCATGATCTCAACATGACAATGTTGCAGTTTAAAAACAAACATGGAGAGAACATGAAAAGGGAGGACCTTACTATCAATACAAGGAAGAGAGGTGACGAGTCTGATCAGAACAAAATAACAATCGGCTTCTTCCACTTTGAGCTTATTTGGGGAAACTATTTTGTGCTTCTTCCATTTGGCTCTGGACGAAGGTGTTGCCCTGAAATTCAACTAGGCCTAATGGTTGTCCATCTAGTGCTGGCACAACTTGTGCATTGTTTTGATTGGGAACTTCCAGAAAACATGTCGCCAAATGATTTGGGTATGATGGAAGAATTTGGAATGACGGTTTCTAGGGCCAAGCATCTACTGGCAATTCTGTCACATCGCCTTCACAAATGA

Protein Analysis

161

Amino Acids

18.54

Weight (kDa)

8.79

Isoelectric Point (pI)

39.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb5_N PF03871 18 - 77 1.5e-10 RNA polymerase Rpb5, N-terminal domain
p450 PF00067 85 - 149 2.3e-07 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000282)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g12350 FvH4_5g12380 FvH4_5g12392 FvH4_5g12400 FvH4_5g12430
malus_domestica MD06G1213300.v1.1 MD06G1213500.v1.1 MD06G1213700.v1.1 MD06G1213800.v1.1 MD06G1213900.v1.1 MD06G1214000.v1.1 MD06G1214400.v1.1 MD14G1224300.v1.1 MD14G1224400.v1.1 MD14G1224600.v1.1 MD14G1224700.v1.1 MD14G1224800.v1.1 MD14G1224900.v1.1 MD14G1225100.v1.1 MD14G1225400.v1.1
prunus_persica Prupe.5G219700_v2.0.a1 Prupe.5G219800_v2.0.a1 Prupe.5G219900_v2.0.a1 Prupe.8G078500_v2.0.a1
pyrus_communis pycom06g19100 pycom14g18590 pycom14g18600 pycom14g18610 pycom14g18660
rosa_chinensis RchiOBHm_Chr0c12g0499591 RchiOBHm_Chr2g0140591 RchiOBHm_Chr2g0140631 RchiOBHm_Chr2g0140641 RchiOBHm_Chr2g0140651 RchiOBHm_Chr4g0417991 RchiOBHm_Chr4g0418001 RchiOBHm_Chr4g0418101 RchiOBHm_Chr4g0418111 RchiOBHm_Chr4g0418121 RchiOBHm_Chr6g0280191 RchiOBHm_Chr6g0280241 RchiOBHm_Chr6g0280251 RchiOBHm_Chr7g0185031 RchiOBHm_Chr7g0185051 RchiOBHm_Chr7g0185081 RchiOBHm_Chr7g0185091 RchiOBHm_Chr7g0185111 RchiOBHm_Chr7g0185131 RchiOBHm_Chr7g0185151 RchiOBHm_Chr7g0185161 RchiOBHm_Chr7g0185191 RchiOBHm_Chr7g0222431
rosa_laevigata RLG00000002061 RLG00000004934 RLG00000004935 RLG00000004937 RLG00000013071 RLG00000013077 RLG00000019621 RLG00000019881 RLG00000019884 RLG00000019887 RLG00000019888 RLG00000028839
rosa_multiflora Rmu_co8014370.1_g000001 Rmu_co8334683.1_g000001 Rmu_co8440383.1_g000001 Rmu_sc0002826.1_g000008 Rmu_sc0002826.1_g000009 Rmu_sc0002826.1_g000030 Rmu_sc0004483.1_g000005 Rmu_sc0004638.1_g000003 Rmu_sc0004638.1_g000004 Rmu_sc0005756.1_g000003 Rmu_sc0006493.1_g000023 Rmu_sc0006493.1_g000024 Rmu_sc0007137.1_g000017 Rmu_sc0008496.1_g000022 Rmu_sc0008769.1_g000003 Rmu_sc0013612.1_g000026 Rmu_sc0013864.1_g000001 Rmu_sc0013864.1_g000007 Rmu_sc0013864.1_g000008 Rmu_sc0030128.1_g000001 Rmu_sc0041660.1_g000001 Rmu_ssc0000289.1_g000001
rosa_roxburghii Rroxscaffold_2G00104640 Rroxscaffold_3G00253970 Rroxscaffold_3G00269170 Rroxscaffold_3G00269200 Rroxscaffold_3G00269210 Rroxscaffold_3G00269220 Rroxscaffold_3G00269230 Rroxscaffold_7G00188320
rosa_rugosa Rorug01G0052300 Rorug05G0212000 Rorug06G0130700 Rorug06G0131100 Rorug06G0466200 Rorug06G0466300 Rorug06G0466400 Rorug06G0466500 Rorug06G0466700 Rorug07G0208500 Rorug07G0294600
rosa_samantha Rh4AG137600 Rh6DG237300 Rh6DG237800 Rh7AG076200 Rh7AG076300 Rh7AG076500 Rh7AG076600 Rh7AG350700 Rh7BG070800 Rh7BG070900 Rh7BG071000 Rh7BG071100
rosa_wichuraiana Rw6G020990 Rw6G021010 Rw7G005900 Rw7G005910 Rw7G005920 Rw7G005940 Rw7G005950 Rw7G005970 Rw7G029600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 11
AcsI RAATTY 2 cut(s) 306, 416
AflIII ACRYGT 1 cut(s) 384
AgsI TTSAA 1 cut(s) 311
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
AoxI GGCC 2 cut(s) 316, 438
ApoI RAATTY 2 cut(s) 306, 416
AspS9I GGNCC 2 cut(s) 166, 438
AsuHPI GGTGA 1 cut(s) 206
AsuII TTCGAA 1 cut(s) 51
AvaII GGWCC 1 cut(s) 166
BccI CCATC 2 cut(s) 339, 403
BcgI CGANNNNNNTGC 2 cut(s) 279, 313
BclI TGATCA 2 cut(s) 100, 205
BfaI CTAG 3 cut(s) 314, 335, 435
BfmI CTRYAG 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 166, 438
BmsI GCATC 2 cut(s) 54, 454
Bpu14I TTCGAA 1 cut(s) 51
BsaBI GATNNNNATC 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 456
Bse8I GATNNNNATC 1 cut(s) 105
BseJI GATNNNNATC 1 cut(s) 105
BseNI ACTGG 1 cut(s) 456
BshFI GGCC 2 cut(s) 318, 440
BsnI GGCC 2 cut(s) 318, 440
Bsp119I TTCGAA 1 cut(s) 51
Bsp143I GATC 3 cut(s) 100, 106, 205
BspANI GGCC 2 cut(s) 318, 440
BspHI TCATGA 1 cut(s) 103
BspT104I TTCGAA 1 cut(s) 51
BsrI ACTGG 1 cut(s) 456
BssMI GATC 3 cut(s) 100, 106, 205
Bst4CI ACNGT 2 cut(s) 61, 430
Bst6I CTCTTC 1 cut(s) 182
BstBI TTCGAA 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 342
BstKTI GATC 3 cut(s) 103, 109, 208
BstMBI GATC 3 cut(s) 100, 106, 205
BstNSI RCATGY 1 cut(s) 388
BstSFI CTRYAG 1 cut(s) 42
BsuRI GGCC 2 cut(s) 318, 440
BtgZI GCGATG 1 cut(s) 452
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 342
CciI TCATGA 1 cut(s) 103
Cfr13I GGNCC 2 cut(s) 166, 438
CviAII CATG 5 cut(s) 104, 115, 143, 154, 385
CviJI RGCY 6 cut(s) 39, 228, 244, 282, 318, 440
CviKI_1 RGCY 6 cut(s) 39, 228, 244, 282, 318, 440
DpnI GATC 3 cut(s) 102, 108, 207
DpnII GATC 3 cut(s) 100, 106, 205
DraI TTTAAA 1 cut(s) 133
Eam1104I CTCTTC 1 cut(s) 182
EarI CTCTTC 1 cut(s) 182
Eco147I AGGCCT 1 cut(s) 318
Eco47I GGWCC 1 cut(s) 166
EcoO109I RGGNCCY 1 cut(s) 166
FaeI CATG 5 cut(s) 107, 118, 146, 157, 388
FaiI YATR 7 cut(s) 44, 105, 116, 144, 155, 386, 407
FatI CATG 5 cut(s) 103, 114, 142, 153, 384
FbaI TGATCA 2 cut(s) 100, 205
FblI GTMKAC 1 cut(s) 11
FspBI CTAG 3 cut(s) 314, 335, 435
HaeIII GGCC 2 cut(s) 318, 440
Hin1II CATG 5 cut(s) 107, 118, 146, 157, 388
HincII GTYRAC 1 cut(s) 12
HindII GTYRAC 1 cut(s) 12
HinfI GANTC 1 cut(s) 200
HphI GGTGA 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 205, 210
Hpy188III TCNNGA 4 cut(s) 83, 104, 285, 377
Hpy8I GTNNAC 1 cut(s) 12
HpyAV CCTTC 2 cut(s) 285, 482
HpyCH4III ACNGT 2 cut(s) 61, 430
HpyCH4V TGCA 3 cut(s) 67, 127, 355
Hsp92II CATG 5 cut(s) 107, 118, 146, 157, 388
Ksp22I TGATCA 2 cut(s) 100, 205
Kzo9I GATC 3 cut(s) 100, 106, 205
LpnPI CCDG 6 cut(s) 68, 270, 315, 326, 390, 437
LweI GCATC 2 cut(s) 54, 454
MaeI CTAG 3 cut(s) 314, 335, 435
MaeIII GTNAC 3 cut(s) 30, 194, 462
MalI GATC 3 cut(s) 102, 108, 207
MboI GATC 3 cut(s) 100, 106, 205
MboII GAAGA 6 cut(s) 34, 37, 199, 223, 263, 425
MluCI AATT 4 cut(s) 93, 306, 416, 456
MlyI GAGTC 1 cut(s) 209
MnlI CCTC 3 cut(s) 29, 157, 185
MseI TTAA 1 cut(s) 132
MslI CAYNNNNRTG 1 cut(s) 119
NdeII GATC 3 cut(s) 100, 106, 205
NlaIII CATG 5 cut(s) 107, 118, 146, 157, 388
NmuCI GTSAC 2 cut(s) 194, 462
NspI RCATGY 1 cut(s) 388
NspV TTCGAA 1 cut(s) 51
PagI TCATGA 1 cut(s) 103
PceI AGGCCT 1 cut(s) 318
PciI ACATGT 1 cut(s) 384
PcsI WCGNNNNNNNCGW 1 cut(s) 17
PflFI GACNNNGTC 1 cut(s) 16
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
PpuMI RGGWCCY 1 cut(s) 166
PscI ACATGT 1 cut(s) 384
Psp5II RGGWCCY 1 cut(s) 166
PspPI GGNCC 2 cut(s) 166, 438
PspPPI RGGWCCY 1 cut(s) 166
PsyI GACNNNGTC 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 119
SalI GTCGAC 1 cut(s) 10
SaqAI TTAA 1 cut(s) 132
Sau3AI GATC 3 cut(s) 100, 106, 205
Sau96I GGNCC 2 cut(s) 166, 438
SchI GAGTC 1 cut(s) 209
SetI ASST 5 cut(s) 82, 171, 196, 246, 296
SfaNI GCATC 2 cut(s) 54, 454
SfcI CTRYAG 1 cut(s) 42
SfuI TTCGAA 1 cut(s) 51
SinI GGWCC 1 cut(s) 166
SmiMI CAYNNNNRTG 1 cut(s) 119
Sse9I AATT 4 cut(s) 93, 306, 416, 456
SseBI AGGCCT 1 cut(s) 318
SspMI CTAG 3 cut(s) 314, 335, 435
StuI AGGCCT 1 cut(s) 318
TaaI ACNGT 2 cut(s) 61, 430
TaqI TCGA 3 cut(s) 11, 20, 51
TasI AATT 4 cut(s) 93, 306, 416, 456
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TscAI CASTG 1 cut(s) 66
TseFI GTSAC 2 cut(s) 194, 462
Tsp45I GTSAC 2 cut(s) 194, 462
TspDTI ATGAA 1 cut(s) 170
TspRI CASTG 1 cut(s) 66
Tth111I GACNNNGTC 1 cut(s) 16
VpaK11BI GGWCC 1 cut(s) 166
XapI RAATTY 2 cut(s) 306, 416
XceI RCATGY 1 cut(s) 388
XcmI CCANNNNNNNNNTGG 1 cut(s) 448
XmiI GTMKAC 1 cut(s) 11
XspI CTAG 3 cut(s) 314, 335, 435
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.