Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008496.1

Orthogroup ID

OG0000282

Physical Location & Seq

Genomic Coordinates Reverse (-)

99592 .. 102089

Gene Structure 2498 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008496.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1317 bp

atgtccatccgtctaggcagtgttccgaccatagtagtctcctcccccaaagctgcagagctattcctcaaaactcacgacactaatttcgccagccggcccaaaatccaagcctcggagtacatatcctacggcacaaagggcatggccttttccgaatatggtccctattggcgccatgtaaggaagctctgtacgcttcagcttttctgtccagcaaaaatagaggctttcgcgccgctgagaaaggatgagctgggagtgctgctgagaaagctcaagaacgctgcagaggaaggtggtgttgtggatgttagtgaggatattggtgtgatgaatgaggacatcacgtacaggatggtgttgggttgtaaaagggatgatcagtttgatttgaaagccattgttgaggaaacgttttccttggctggggctttcaatatatctgattttgttccttcccttgctgcacttgatattcaggggttgactaagcgaatgaagaaagttagcaagacgatcgataagctcttggagaagataattgacgaccatgaacaagttgctaaaactacgagtgggaaacaaggcaagcatgaggactttgtagacgtcttgctttcattaatgaaccaaccgttgaactcgaatggtgagcaagttcattttcttgatcgaacaaatgtgaaagccatcttactagacatgcttacggcggcttttgatacttcggcctcatcgattgtttggagcctttccgagctcttaaggcatccaagggttatgaagaaactccaaaaagagctccaaactgtggttggcatggaccgaatggtggaagagactgatttgccgaagctggaatacttgagtatggtggtcaaggagagcttgagactgcacccggtggcaccattactagtcccacatgaatctatcgaggacattacaattgatggatatgacatccccaagaagtcgcgaatcatagtgaatttctggagcattggaagagatcctaatgtttggtcggaaaatgttgaggaattttatcctgaaaggttcatgaacagcaatataaacctccggggacatgactttcagctcatcccatttgggtctggccgaagaggttgtccgggtctgcaattagggctaaccacagttcggctagttctggcacagctggtgcactgctttaactgggagctcccagcaggcatactacctcaagacttggacatgtccgagaaattcggtttatcaatgtcaaaggcccaacacttgcttgccaagccgacctaccgtcttctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0008150 GO:0008152 GO:0009058 GO:0012505 GO:0016020 GO:0016491 GO:0016705 GO:0016709 GO:0019748 GO:0031090 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0044550 GO:0055114 GO:0098827

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p450

Protein Analysis

438

Amino Acids

49.34

Weight (kDa)

6.44

Isoelectric Point (pI)

38.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000282)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g12350 FvH4_5g12380 FvH4_5g12392 FvH4_5g12400 FvH4_5g12430
malus_domestica	MD06G1213300.v1.1 MD06G1213500.v1.1 MD06G1213700.v1.1 MD06G1213800.v1.1 MD06G1213900.v1.1 MD06G1214000.v1.1 MD06G1214400.v1.1 MD14G1224300.v1.1 MD14G1224400.v1.1 MD14G1224600.v1.1 MD14G1224700.v1.1 MD14G1224800.v1.1 MD14G1224900.v1.1 MD14G1225100.v1.1 MD14G1225400.v1.1
prunus_persica	Prupe.5G219700_v2.0.a1 Prupe.5G219800_v2.0.a1 Prupe.5G219900_v2.0.a1 Prupe.8G078500_v2.0.a1
pyrus_communis	pycom06g19100 pycom14g18590 pycom14g18600 pycom14g18610 pycom14g18660
rosa_chinensis	RchiOBHm_Chr0c12g0499591 RchiOBHm_Chr2g0140591 RchiOBHm_Chr2g0140631 RchiOBHm_Chr2g0140641 RchiOBHm_Chr2g0140651 RchiOBHm_Chr4g0417991 RchiOBHm_Chr4g0418001 RchiOBHm_Chr4g0418101 RchiOBHm_Chr4g0418111 RchiOBHm_Chr4g0418121 RchiOBHm_Chr6g0280191 RchiOBHm_Chr6g0280241 RchiOBHm_Chr6g0280251 RchiOBHm_Chr7g0185031 RchiOBHm_Chr7g0185051 RchiOBHm_Chr7g0185081 RchiOBHm_Chr7g0185091 RchiOBHm_Chr7g0185111 RchiOBHm_Chr7g0185131 RchiOBHm_Chr7g0185151 RchiOBHm_Chr7g0185161 RchiOBHm_Chr7g0185191 RchiOBHm_Chr7g0222431
rosa_laevigata	RLG00000002061 RLG00000004934 RLG00000004935 RLG00000004937 RLG00000013071 RLG00000013077 RLG00000019621 RLG00000019881 RLG00000019884 RLG00000019887 RLG00000019888 RLG00000028839
rosa_multiflora	Rmu_co8014370.1_g000001 Rmu_co8334683.1_g000001 Rmu_co8440383.1_g000001 Rmu_sc0002826.1_g000008 Rmu_sc0002826.1_g000009 Rmu_sc0002826.1_g000030 Rmu_sc0004483.1_g000005 Rmu_sc0004638.1_g000003 Rmu_sc0004638.1_g000004 Rmu_sc0005756.1_g000003 Rmu_sc0006493.1_g000023 Rmu_sc0006493.1_g000024 Rmu_sc0007137.1_g000017 Rmu_sc0008496.1_g000022 Rmu_sc0008769.1_g000003 Rmu_sc0013612.1_g000026 Rmu_sc0013864.1_g000001 Rmu_sc0013864.1_g000007 Rmu_sc0013864.1_g000008 Rmu_sc0030128.1_g000001 Rmu_sc0041660.1_g000001 Rmu_ssc0000289.1_g000001
rosa_roxburghii	Rroxscaffold_2G00104640 Rroxscaffold_3G00253970 Rroxscaffold_3G00269170 Rroxscaffold_3G00269200 Rroxscaffold_3G00269210 Rroxscaffold_3G00269220 Rroxscaffold_3G00269230 Rroxscaffold_7G00188320
rosa_rugosa	Rorug01G0052300 Rorug05G0212000 Rorug06G0130700 Rorug06G0131100 Rorug06G0466200 Rorug06G0466300 Rorug06G0466400 Rorug06G0466500 Rorug06G0466700 Rorug07G0208500 Rorug07G0294600
rosa_samantha	Rh4AG137600 Rh6DG237300 Rh6DG237800 Rh7AG076200 Rh7AG076300 Rh7AG076500 Rh7AG076600 Rh7AG350700 Rh7BG070800 Rh7BG070900 Rh7BG071000 Rh7BG071100
rosa_wichuraiana	Rw6G020990 Rw6G021010 Rw7G005900 Rw7G005910 Rw7G005920 Rw7G005940 Rw7G005950 Rw7G005970 Rw7G029600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	615
AccB1I	GGYRCC	2 cut(s)	174, 910
AccB7I	CCANNNNNTGG	1 cut(s)	814
AccI	GTMKAC	1 cut(s)	609
AccII	CGCG	2 cut(s)	236, 982
AciI	CCGC	2 cut(s)	239, 716
AclI	AACGTT	1 cut(s)	416
AclWI	GGATC	1 cut(s)	1010
AcoI	YGGCCR	1 cut(s)	1123
AcsI	RAATTY	3 cut(s)	994, 1046, 1253
AcuI	CTGAAG	1 cut(s)	185
AcyI	GRCGYC	2 cut(s)	175, 612
AdeI	CACNNNGTG	1 cut(s)	907
AfaI	GTAC	3 cut(s)	122, 196, 353
AfiI	CCNNNNNNNGG	5 cut(s)	115, 429, 814, 835, 1167
AflII	CTTAAG	1 cut(s)	766
AflIII	ACRYGT	1 cut(s)	1242
AgsI	TTSAA	3 cut(s)	397, 439, 643
AhdI	GACNNNNNGTC	1 cut(s)	1305
AhlI	ACTAGT	1 cut(s)	919
Alw21I	GWGCWC	4 cut(s)	765, 807, 1194, 1212
Alw26I	GTCTC	3 cut(s)	43, 836, 889
Alw44I	GTGCAC	1 cut(s)	1190
AlwI	GGATC	1 cut(s)	1010
AoxI	GGCC	5 cut(s)	98, 147, 732, 1123, 1275
ApaLI	GTGCAC	1 cut(s)	1190
ApeKI	GCWGC	4 cut(s)	53, 265, 287, 467
ApoI	RAATTY	3 cut(s)	994, 1046, 1253
ArsI	GACNNNNNNTTYG	4 cut(s)	71, 103, 1120, 1152
AseI	ATTAAT	1 cut(s)	626
AspLEI	GCGC	2 cut(s)	177, 238
AspS9I	GGNCC	4 cut(s)	99, 164, 826, 1276
AsuC2I	CCSGG	3 cut(s)	905, 1088, 1140
AsuHPI	GGTGA	1 cut(s)	665
AvaII	GGWCC	2 cut(s)	164, 826
BaeGI	GKGCMC	1 cut(s)	1194
BanI	GGYRCC	2 cut(s)	174, 910
BanII	GRGCYC	3 cut(s)	765, 807, 1212
BarI	GAAGNNNNNNTAC	2 cut(s)	848, 880
BbsI	GAAGAC	1 cut(s)	1301
Bbv12I	GWGCWC	4 cut(s)	765, 807, 1194, 1212
BbvI	GCAGC	4 cut(s)	40, 252, 274, 454
BccI	CCATC	4 cut(s)	14, 352, 701, 950
BceAI	ACGGC	2 cut(s)	148, 729
BcgI	CGANNNNNNTGC	2 cut(s)	502, 536
BclI	TGATCA	1 cut(s)	382
BcnI	CCSGG	3 cut(s)	905, 1088, 1140
BcoDI	GTCTC	3 cut(s)	43, 836, 889
BcuI	ACTAGT	1 cut(s)	919
BfaI	CTAG	4 cut(s)	14, 701, 920, 1172
BfmI	CTRYAG	3 cut(s)	54, 288, 1313
BfoI	RGCGCY	1 cut(s)	178
BfrI	CTTAAG	1 cut(s)	766
BisI	GCNGC	6 cut(s)	54, 239, 266, 288, 468, 717
BlsI	GCNGC	6 cut(s)	55, 240, 267, 289, 469, 718
Bme1390I	CCNGG	3 cut(s)	905, 1088, 1140
Bme18I	GGWCC	2 cut(s)	164, 826
BmeRI	GACNNNNNGTC	1 cut(s)	1305
BmgT120I	GGNCC	4 cut(s)	99, 164, 826, 1276
BmiI	GGNNCC	4 cut(s)	166, 176, 752, 912
BmrFI	CCNGG	3 cut(s)	905, 1088, 1140
BmrI	ACTGGG	1 cut(s)	1213
BmsI	GCATC	1 cut(s)	781
BmuI	ACTGGG	1 cut(s)	1213
BpiI	GAAGAC	1 cut(s)	1301
BpmI	CTGGAG	1 cut(s)	1021
BpuEI	CTTGAG	4 cut(s)	263, 889, 913, 1215
BpuMI	CCSGG	3 cut(s)	905, 1088, 1140
Bsa29I	ATCGAT	2 cut(s)	522, 740
BsaAI	YACGTR	1 cut(s)	351
BsaHI	GRCGYC	2 cut(s)	175, 612
BsaJI	CCNNGG	4 cut(s)	114, 423, 776, 1087
Bsc4I	CCNNNNNNNGG	5 cut(s)	115, 429, 814, 835, 1167
Bse118I	RCCGGY	1 cut(s)	96
Bse1I	ACTGG	1 cut(s)	1208
BseCI	ATCGAT	2 cut(s)	522, 740
BseDI	CCNNGG	4 cut(s)	114, 423, 776, 1087
BseGI	GGATG	8 cut(s)	6, 256, 316, 363, 385, 772, 966, 1107
BseLI	CCNNNNNNNGG	5 cut(s)	115, 429, 814, 835, 1167
BseMII	CTCAG	2 cut(s)	233, 260
BseNI	ACTGG	1 cut(s)	1208
BseRI	GAGGAG	1 cut(s)	31
BseSI	GKGCMC	1 cut(s)	1194
BseXI	GCAGC	4 cut(s)	40, 252, 274, 454
BseYI	CCCAGC	3 cut(s)	256, 428, 1213
BsgI	GTGCAG	2 cut(s)	453, 884
Bsh1236I	CGCG	2 cut(s)	236, 982
Bsh1285I	CGRYCG	1 cut(s)	522
BshFI	GGCC	5 cut(s)	100, 149, 734, 1125, 1277
BshNI	GGYRCC	2 cut(s)	174, 910
BshVI	ATCGAT	2 cut(s)	522, 740
BsiEI	CGRYCG	1 cut(s)	522
BsiHKAI	GWGCWC	4 cut(s)	765, 807, 1194, 1212
BsiSI	CCGG	4 cut(s)	97, 905, 1087, 1139
BslFI	GGGAC	3 cut(s)	150, 908, 1104
BslI	CCNNNNNNNGG	5 cut(s)	115, 429, 814, 835, 1167
BsmAI	GTCTC	3 cut(s)	43, 836, 889
BsmFI	GGGAC	3 cut(s)	150, 908, 1104
BsnI	GGCC	5 cut(s)	100, 149, 734, 1125, 1277
Bsp1286I	GDGCHC	4 cut(s)	765, 807, 1194, 1212
Bsp143I	GATC	4 cut(s)	382, 519, 673, 1015
Bsp68I	TCGCGA	1 cut(s)	982
BspACI	CCGC	2 cut(s)	239, 716
BspANI	GGCC	5 cut(s)	100, 149, 734, 1125, 1277
BspCNI	CTCAG	2 cut(s)	234, 261
BspDI	ATCGAT	2 cut(s)	522, 740
BspFNI	CGCG	2 cut(s)	236, 982
BspHI	TCATGA	1 cut(s)	1065
BspLI	GGNNCC	4 cut(s)	166, 176, 752, 912
BspMAI	CTGCAG	2 cut(s)	58, 292
BspPI	GGATC	1 cut(s)	1010
BspT107I	GGYRCC	2 cut(s)	174, 910
BspTI	CTTAAG	1 cut(s)	766
BsrFI	RCCGGY	1 cut(s)	96
BsrI	ACTGG	1 cut(s)	1208
BssAI	RCCGGY	1 cut(s)	96
BssECI	CCNNGG	4 cut(s)	114, 423, 776, 1087
BssMI	GATC	4 cut(s)	382, 519, 673, 1015
BssNI	GRCGYC	2 cut(s)	175, 612
BssT1I	CCWWGG	2 cut(s)	423, 776
Bst4CI	ACNGT	4 cut(s)	639, 814, 1165, 1307
Bst6I	CTCTTC	3 cut(s)	834, 1006, 1123
BstACI	GRCGYC	2 cut(s)	175, 612
BstAFI	CTTAAG	1 cut(s)	766
BstBAI	YACGTR	1 cut(s)	351
BstC8I	GCNNGC	5 cut(s)	94, 98, 593, 1219, 1290
BstDEI	CTNAG	3 cut(s)	242, 269, 492
BstF5I	GGATG	8 cut(s)	6, 256, 316, 363, 385, 772, 966, 1107
BstFNI	CGCG	2 cut(s)	236, 982
BstH2I	RGCGCY	1 cut(s)	178
BstHHI	GCGC	2 cut(s)	177, 238
BstKTI	GATC	4 cut(s)	385, 522, 676, 1018
BstMAI	GTCTC	3 cut(s)	43, 836, 889
BstMBI	GATC	4 cut(s)	382, 519, 673, 1015
BstMCI	CGRYCG	1 cut(s)	522
BstMWI	GCNNNNNNNGC	7 cut(s)	141, 196, 262, 274, 769, 1153, 1294
BstNSI	RCATGY	2 cut(s)	709, 1246
BstSCI	CCNGG	3 cut(s)	903, 1086, 1138
BstSFI	CTRYAG	3 cut(s)	54, 288, 1313
BstSLI	GKGCMC	1 cut(s)	1194
BstUI	CGCG	2 cut(s)	236, 982
BstV1I	GCAGC	4 cut(s)	40, 252, 274, 454
BstV2I	GAAGAC	1 cut(s)	1301
BstX2I	RGATCY	1 cut(s)	1015
BstYI	RGATCY	1 cut(s)	1015
Bsu15I	ATCGAT	2 cut(s)	522, 740
BsuRI	GGCC	5 cut(s)	100, 149, 734, 1125, 1277
BsuTUI	ATCGAT	2 cut(s)	522, 740
BtsCI	GGATG	8 cut(s)	6, 256, 316, 363, 385, 772, 966, 1107
BtsI	GCAGTG	2 cut(s)	25, 1192
BtsIMutI	CAGTG	2 cut(s)	25, 1192
BtuMI	TCGCGA	1 cut(s)	982
Cac8I	GCNNGC	5 cut(s)	94, 98, 593, 1219, 1290
CciI	TCATGA	1 cut(s)	1065
CfoI	GCGC	2 cut(s)	177, 238
Cfr10I	RCCGGY	1 cut(s)	96
Cfr13I	GGNCC	4 cut(s)	99, 164, 826, 1276
ClaI	ATCGAT	2 cut(s)	522, 740
Csp6I	GTAC	3 cut(s)	121, 195, 352
CviQI	GTAC	3 cut(s)	121, 195, 352
DdeI	CTNAG	3 cut(s)	242, 269, 492
DinI	GGCGCC	1 cut(s)	176
DpnI	GATC	4 cut(s)	384, 521, 675, 1017
DpnII	GATC	4 cut(s)	382, 519, 673, 1015
DraIII	CACNNNGTG	1 cut(s)	907
DriI	GACNNNNNGTC	1 cut(s)	1305
EaeI	YGGCCR	1 cut(s)	1123
Eam1104I	CTCTTC	3 cut(s)	834, 1006, 1123
Eam1105I	GACNNNNNGTC	1 cut(s)	1305
EarI	CTCTTC	3 cut(s)	834, 1006, 1123
Ecl136II	GAGCTC	3 cut(s)	763, 805, 1210
Eco130I	CCWWGG	2 cut(s)	423, 776
Eco24I	GRGCYC	3 cut(s)	765, 807, 1212
Eco47I	GGWCC	2 cut(s)	164, 826
Eco53kI	GAGCTC	3 cut(s)	763, 805, 1210
Eco57I	CTGAAG	1 cut(s)	185
EcoICRI	GAGCTC	3 cut(s)	763, 805, 1210
EcoT14I	CCWWGG	2 cut(s)	423, 776
EcoT38I	GRGCYC	3 cut(s)	765, 807, 1212
EgeI	GGCGCC	1 cut(s)	176
EheI	GGCGCC	1 cut(s)	176
ErhI	CCWWGG	2 cut(s)	423, 776
FalI	AAGNNNNNCTT	2 cut(s)	875, 907
FaqI	GGGAC	3 cut(s)	150, 908, 1104
FbaI	TGATCA	1 cut(s)	382
FblI	GTMKAC	1 cut(s)	609
Fnu4HI	GCNGC	6 cut(s)	54, 239, 266, 288, 468, 717
FokI	GGATG	7 cut(s)	263, 323, 370, 392, 759, 953, 1094
FriOI	GRGCYC	3 cut(s)	765, 807, 1212
Fsp4HI	GCNGC	6 cut(s)	54, 239, 266, 288, 468, 717
FspBI	CTAG	4 cut(s)	14, 701, 920, 1172
GlaI	GCGC	2 cut(s)	176, 237
GluI	GCNGC	6 cut(s)	54, 239, 266, 288, 468, 717
GsaI	CCCAGC	3 cut(s)	260, 432, 1217
GsuI	CTGGAG	1 cut(s)	1021
HaeII	RGCGCY	1 cut(s)	178
HaeIII	GGCC	5 cut(s)	100, 149, 734, 1125, 1277
HapII	CCGG	4 cut(s)	97, 905, 1087, 1139
HhaI	GCGC	2 cut(s)	177, 238
Hin1I	GRCGYC	2 cut(s)	175, 612
Hin6I	GCGC	2 cut(s)	175, 236
HinP1I	GCGC	2 cut(s)	175, 236
HincII	GTYRAC	1 cut(s)	489
HindII	GTYRAC	1 cut(s)	489
HinfI	GANTC	2 cut(s)	932, 984
HpaII	CCGG	4 cut(s)	97, 905, 1087, 1139
HphI	GGTGA	1 cut(s)	665
Hpy166II	GTNNAC	3 cut(s)	489, 610, 1192
Hpy188I	TCNGA	7 cut(s)	27, 118, 157, 448, 760, 1033, 1249
Hpy188III	TCNNGA	8 cut(s)	77, 280, 671, 981, 1000, 1055, 1066, 1232
Hpy8I	GTNNAC	3 cut(s)	489, 610, 1192
HpyAV	CCTTC	2 cut(s)	290, 468
HpyCH4III	ACNGT	4 cut(s)	639, 814, 1165, 1307
HpyCH4IV	ACGT	3 cut(s)	350, 416, 612
HpyCH4V	TGCA	6 cut(s)	56, 290, 470, 901, 1147, 1192
HpyF10VI	GCNNNNNNNGC	7 cut(s)	141, 196, 262, 274, 769, 1153, 1294
HpyF3I	CTNAG	3 cut(s)	242, 269, 492
HpySE526I	ACGT	3 cut(s)	350, 416, 612
Hsp92I	GRCGYC	2 cut(s)	175, 612
HspAI	GCGC	2 cut(s)	175, 236
KasI	GGCGCC	1 cut(s)	174
KroI	GCCGGC	1 cut(s)	96
KroNI	GCCGGC	1 cut(s)	98
Ksp22I	TGATCA	1 cut(s)	382
Kzo9I	GATC	4 cut(s)	382, 519, 673, 1015
LmnI	GCTCC	5 cut(s)	750, 810, 1002, 1207, 1215
Lsp1109I	GCAGC	4 cut(s)	40, 252, 274, 454
LweI	GCATC	1 cut(s)	781
MaeI	CTAG	4 cut(s)	14, 701, 920, 1172
MaeII	ACGT	3 cut(s)	350, 416, 612
MalI	GATC	4 cut(s)	384, 521, 675, 1017
MboI	GATC	4 cut(s)	382, 519, 673, 1015
MboII	GAAGA	7 cut(s)	514, 550, 799, 851, 1023, 1140, 1301
MfeI	CAATTG	1 cut(s)	951
MflI	RGATCY	1 cut(s)	1015
MhlI	GDGCHC	4 cut(s)	765, 807, 1194, 1212
MluCI	AATT	7 cut(s)	85, 543, 951, 994, 1046, 1148, 1253
Mly113I	GGCGCC	1 cut(s)	175
MmeI	TCCRAC	2 cut(s)	50, 1011
MroNI	GCCGGC	1 cut(s)	96
MseI	TTAA	3 cut(s)	626, 767, 1200
MspA1I	CMGCKG	2 cut(s)	241, 1186
MspCI	CTTAAG	1 cut(s)	766
MspI	CCGG	4 cut(s)	97, 905, 1087, 1139
MspR9I	CCNGG	3 cut(s)	905, 1088, 1140
MunI	CAATTG	1 cut(s)	951
MvnI	CGCG	2 cut(s)	236, 982
MwoI	GCNNNNNNNGC	7 cut(s)	141, 196, 262, 274, 769, 1153, 1294
NaeI	GCCGGC	1 cut(s)	98
NarI	GGCGCC	1 cut(s)	175
NciI	CCSGG	3 cut(s)	905, 1088, 1140
NdeII	GATC	4 cut(s)	382, 519, 673, 1015
NgoMIV	GCCGGC	1 cut(s)	96
NlaIV	GGNNCC	4 cut(s)	166, 176, 752, 912
NruI	TCGCGA	1 cut(s)	982
NspI	RCATGY	2 cut(s)	709, 1246
PagI	TCATGA	1 cut(s)	1065
PciI	ACATGT	1 cut(s)	1242
PcsI	WCGNNNNNNNCGW	1 cut(s)	737
PdiI	GCCGGC	1 cut(s)	98
PfeI	GAWTC	2 cut(s)	932, 984
PflMI	CCANNNNNTGG	1 cut(s)	814
PkrI	GCNGC	6 cut(s)	55, 240, 267, 289, 469, 718
Ple19I	CGATCG	1 cut(s)	522
PluTI	GGCGCC	1 cut(s)	178
Ppu21I	YACGTR	1 cut(s)	351
PscI	ACATGT	1 cut(s)	1242
PshBI	ATTAAT	1 cut(s)	626
Psp124BI	GAGCTC	3 cut(s)	765, 807, 1212
Psp1406I	AACGTT	1 cut(s)	416
PspFI	CCCAGC	3 cut(s)	256, 428, 1213
PspN4I	GGNNCC	4 cut(s)	166, 176, 752, 912
PspPI	GGNCC	4 cut(s)	99, 164, 826, 1276
PstI	CTGCAG	2 cut(s)	58, 292
PsuI	RGATCY	1 cut(s)	1015
PvuI	CGATCG	1 cut(s)	522
PvuII	CAGCTG	1 cut(s)	1186
RruI	TCGCGA	1 cut(s)	982
RsaI	GTAC	3 cut(s)	122, 196, 353
RsaNI	GTAC	3 cut(s)	121, 195, 352
SacI	GAGCTC	3 cut(s)	765, 807, 1212
SaqAI	TTAA	3 cut(s)	626, 767, 1200
SatI	GCNGC	6 cut(s)	54, 239, 266, 288, 468, 717
Sau3AI	GATC	4 cut(s)	382, 519, 673, 1015
Sau96I	GGNCC	4 cut(s)	99, 164, 826, 1276
ScrFI	CCNGG	3 cut(s)	905, 1088, 1140
SduI	GDGCHC	4 cut(s)	765, 807, 1194, 1212
SfaNI	GCATC	1 cut(s)	781
SfcI	CTRYAG	3 cut(s)	54, 288, 1313
SfoI	GGCGCC	1 cut(s)	176
SinI	GGWCC	2 cut(s)	164, 826
SmlI	CTYRAG	5 cut(s)	278, 766, 868, 892, 1230
SmoI	CTYRAG	5 cut(s)	278, 766, 868, 892, 1230
SpeI	ACTAGT	1 cut(s)	919
Sse9I	AATT	7 cut(s)	85, 543, 951, 994, 1046, 1148, 1253
SsiI	CCGC	2 cut(s)	239, 716
SspDI	GGCGCC	1 cut(s)	174
SspMI	CTAG	4 cut(s)	14, 701, 920, 1172
SstI	GAGCTC	3 cut(s)	765, 807, 1212
StyD4I	CCNGG	3 cut(s)	903, 1086, 1138
StyI	CCWWGG	2 cut(s)	423, 776
TaaI	ACNGT	4 cut(s)	639, 814, 1165, 1307
TaiI	ACGT	3 cut(s)	353, 419, 615
TaqI	TCGA	5 cut(s)	522, 647, 676, 740, 939
TaqII	GACCGA	1 cut(s)	843
TasI	AATT	7 cut(s)	85, 543, 951, 994, 1046, 1148, 1253
TatI	WGTACW	1 cut(s)	120
TauI	GCSGC	2 cut(s)	241, 719
TfiI	GAWTC	2 cut(s)	932, 984
Tru1I	TTAA	3 cut(s)	626, 767, 1200
Tru9I	TTAA	3 cut(s)	626, 767, 1200
TscAI	CASTG	2 cut(s)	25, 1199
TseI	GCWGC	4 cut(s)	53, 265, 287, 467
TspRI	CASTG	2 cut(s)	25, 1199
Van91I	CCANNNNNTGG	1 cut(s)	814
Vha464I	CTTAAG	1 cut(s)	766
VneI	GTGCAC	1 cut(s)	1190
VpaK11BI	GGWCC	2 cut(s)	164, 826
VspI	ATTAAT	1 cut(s)	626
XapI	RAATTY	3 cut(s)	994, 1046, 1253
XceI	RCATGY	2 cut(s)	709, 1246
XcmI	CCANNNNNNNNNTGG	1 cut(s)	815
XmiI	GTMKAC	1 cut(s)	609
XspI	CTAG	4 cut(s)	14, 701, 920, 1172
ZraI	GACGTC	1 cut(s)	613

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.