Rmu_sc0001171.1_g000026

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001171.1
Physical Location & Seq
Reverse (-)
121553 .. 121831
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001171.1_g000026.1.cds

Sequence Viewer

Length: 279 bp
atgaaccctgaatattttccagcgccagaagagtttgatcctacaaggttcgagaaagcaactcctccgccttacacaaacatcccattcgggagcggtcctcgaatttgccccggaaaggactacgctcgtctgcaaattcttagttttatgcaccatcttgttataagattcaaatgggaacttgtgaaccctaattgcaagatcacaggtggtatgaatccctttccagttgatgggctgaaggttcgcctccaagctcaacccagtcaagcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.46

Weight (kDa)

8.69

Isoelectric Point (pI)

57.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000192)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36110 AT5G36110 AT5G36130 AT5G36140
fragaria_vesca FvH4_2g39160 FvH4_3g15030 FvH4_3g38021 FvH4_3g38080 FvH4_4g00250 FvH4_4g01400 FvH4_5g18260 FvH4_5g18260 FvH4_5g29490 FvH4_7g03260 FvH4_7g12550 FvH4_7g12560 FvH4_7g14310 FvH4_7g14330
malus_domestica MD04G1002500.v1.1 MD11G1006100.v1.1 MD11G1157200.v1.1 MD11G1157300.v1.1 MD13G1116400.v1.1 MD13G1219600.v1.1 MD13G1284800.v1.1 MD16G1278300.v1.1 MD17G1219500.v1.1
prunus_persica Prupe.1G002500_v2.0.a1 Prupe.6G120400_v2.0.a1
pyrus_communis pycom04g00270 pycom10g20130 pycom11g12750 pycom16g24900 pycom17g22420 pycom420g00590
rosa_chinensis RchiOBHm_Chr1g0325391 RchiOBHm_Chr1g0340921 RchiOBHm_Chr1g0355301 RchiOBHm_Chr1g0355311 RchiOBHm_Chr1g0355331 RchiOBHm_Chr1g0355341 RchiOBHm_Chr2g0153901 RchiOBHm_Chr4g0384961 RchiOBHm_Chr4g0384991 RchiOBHm_Chr4g0393781 RchiOBHm_Chr4g0433801 RchiOBHm_Chr5g0024681 RchiOBHm_Chr5g0024711 RchiOBHm_Chr5g0024721 RchiOBHm_Chr5g0024791 RchiOBHm_Chr7g0177321 RchiOBHm_Chr7g0177351 RchiOBHm_Chr7g0177361
rosa_laevigata RLG00000001838 RLG00000005543 RLG00000010261 RLG00000028154 RLG00000028157 RLG00000028158 RLG00000028162 RLG00000030142 RLG00000032812 RLG00000032813 RLG00000032814
rosa_multiflora Rmu_co8235405.1_g000001 Rmu_co8395679.1_g000001 Rmu_co8439995.1_g000001 Rmu_sc0000999.1_g000011 Rmu_sc0001171.1_g000026 Rmu_sc0002766.1_g000009 Rmu_sc0003822.1_g000014 Rmu_sc0004135.1_g000001 Rmu_sc0004135.1_g000004 Rmu_sc0004135.1_g000006 Rmu_sc0004135.1_g000012 Rmu_sc0004135.1_g000017 Rmu_sc0004135.1_g000020 Rmu_sc0004637.1_g000001 Rmu_sc0005310.1_g000005 Rmu_sc0006151.1_g000002 Rmu_sc0007192.1_g000013 Rmu_sc0008633.1_g000002 Rmu_sc0020285.1_g000001
rosa_roxburghii Rroxscaffold_1G00054590 Rroxscaffold_2G00098180 Rroxscaffold_3G00234050 Rroxscaffold_3G00236820 Rroxscaffold_3G00275940 Rroxscaffold_4G00300500 Rroxscaffold_4G00300510 Rroxscaffold_5G00332950 Rroxscaffold_7G00188110
rosa_rugosa Rorug01G0051800 Rorug01G0051900 Rorug01G0052200 Rorug01G0052300 Rorug01G0052300 Rorug01G0246500 Rorug01G0246500 Rorug01G0246600 Rorug02G0411000 Rorug03G0298400 Rorug03G0298400 Rorug06G0404900 Rorug06G0405200 Rorug07G0209500 Rorug07G0227800
rosa_samantha Rh1AG066900 Rh1AG258800 Rh1AG259000 Rh1BG055200 Rh1BG055300 Rh1BG228400 Rh1BG228500 Rh1BG228600 Rh1BG228700 Rh1CG068300 Rh1CG242400 Rh1CG242600 Rh1CG242800 Rh1CG242900 Rh1CG243000 Rh1DG073000 Rh1DG256200 Rh1DG256300 Rh1DG256400 Rh1DG256500 Rh4AG002300 Rh4AG326300 Rh4BG001800 Rh4CG002200 Rh4DG001800 Rh5BG173900 Rh5CG190900 Rh5DG175500 Rh7AG004800 Rh7AG004900 Rh7AG349600 Rh7AG375800 Rh7BG004900 Rh7BG362800 Rh7CG004700 Rh7CG366800 Rh7CG394300 Rh7DG004600 Rh7DG004700 Rh7DG374000
rosa_wichuraiana Rw0G008010 Rw0G008840 Rw1G022840 Rw1G022850 Rw4G000710 Rw4G028240 Rw4G028290 Rw5G015960 Rw7G000400 Rw7G029670 Rw7G031540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 167
AccB7I CCANNNNNTGG 1 cut(s) 236
AccBSI CCGCTC 1 cut(s) 96
AciI CCGC 2 cut(s) 68, 96
AclWI GGATC 1 cut(s) 32
AcsI RAATTY 2 cut(s) 105, 138
AcuI CTGAAG 1 cut(s) 263
AfiI CCNNNNNNNGG 2 cut(s) 118, 236
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 260, 275
AluI AGCT 2 cut(s) 260, 275
AlwI GGATC 1 cut(s) 32
ApoI RAATTY 2 cut(s) 105, 138
Asp700I GAANNNNTTC 1 cut(s) 15
AspLEI GCGC 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 98
AsuC2I CCSGG 1 cut(s) 114
AvaII GGWCC 1 cut(s) 98
BccI CCATC 2 cut(s) 165, 230
BcnI CCSGG 1 cut(s) 114
BfoI RGCGCY 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 114
Bme18I GGWCC 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 114
BmrI ACTGGG 1 cut(s) 261
BmuI ACTGGG 1 cut(s) 261
BplI GAGNNNNNCTC 2 cut(s) 85, 117
BpuMI CCSGG 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 112
Bsc4I CCNNNNNNNGG 2 cut(s) 118, 236
Bse1I ACTGG 2 cut(s) 230, 267
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 1 cut(s) 81
BseLI CCNNNNNNNGG 2 cut(s) 118, 236
BseNI ACTGG 2 cut(s) 230, 267
BseRI GAGGAG 1 cut(s) 54
BsiSI CCGG 1 cut(s) 114
BslI CCNNNNNNNGG 2 cut(s) 118, 236
Bsp143I GATC 2 cut(s) 37, 204
BspACI CCGC 2 cut(s) 68, 96
BspPI GGATC 1 cut(s) 32
BsrBI CCGCTC 1 cut(s) 96
BsrI ACTGG 2 cut(s) 230, 267
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 2 cut(s) 37, 204
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 143
BstF5I GGATG 1 cut(s) 81
BstH2I RGCGCY 1 cut(s) 26
BstHHI GCGC 1 cut(s) 25
BstKTI GATC 2 cut(s) 40, 207
BstMBI GATC 2 cut(s) 37, 204
BstSCI CCNGG 1 cut(s) 112
BtsCI GGATG 1 cut(s) 81
CfoI GCGC 1 cut(s) 25
Cfr13I GGNCC 1 cut(s) 98
CviJI RGCY 3 cut(s) 241, 260, 275
CviKI_1 RGCY 3 cut(s) 241, 260, 275
DdeI CTNAG 1 cut(s) 143
DpnI GATC 2 cut(s) 39, 206
DpnII GATC 2 cut(s) 37, 204
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
EciI GGCGGA 1 cut(s) 57
Eco47I GGWCC 1 cut(s) 98
Eco57I CTGAAG 1 cut(s) 263
FaiI YATR 3 cut(s) 152, 167, 218
FokI GGATG 1 cut(s) 68
GlaI GCGC 1 cut(s) 24
HaeII RGCGCY 1 cut(s) 26
HapII CCGG 1 cut(s) 114
HhaI GCGC 1 cut(s) 25
Hin6I GCGC 1 cut(s) 23
HinP1I GCGC 1 cut(s) 23
HindIII AAGCTT 1 cut(s) 273
HinfI GANTC 2 cut(s) 171, 220
HpaII CCGG 1 cut(s) 114
Hpy166II GTNNAC 1 cut(s) 190
Hpy188III TCNNGA 2 cut(s) 52, 91
Hpy8I GTNNAC 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 238
HpyCH4V TGCA 3 cut(s) 136, 154, 201
HpyF3I CTNAG 1 cut(s) 143
HspAI GCGC 1 cut(s) 23
Kzo9I GATC 2 cut(s) 37, 204
LmnI GCTCC 1 cut(s) 93
LpnPI CCDG 6 cut(s) 21, 33, 39, 127, 195, 243
MalI GATC 2 cut(s) 39, 206
MbiI CCGCTC 1 cut(s) 96
MboI GATC 2 cut(s) 37, 204
MboII GAAGA 1 cut(s) 41
MluCI AATT 3 cut(s) 105, 138, 196
MnlI CCTC 3 cut(s) 75, 111, 263
MroXI GAANNNNTTC 1 cut(s) 15
MseI TTAA 1 cut(s) 277
MspI CCGG 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 114
NciI CCSGG 1 cut(s) 114
NdeII GATC 2 cut(s) 37, 204
PdmI GAANNNNTTC 1 cut(s) 15
PfeI GAWTC 2 cut(s) 171, 220
PflMI CCANNNNNTGG 1 cut(s) 236
PsiI TTATAA 1 cut(s) 167
PspPI GGNCC 1 cut(s) 98
SaqAI TTAA 1 cut(s) 277
Sau3AI GATC 2 cut(s) 37, 204
Sau96I GGNCC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 114
SetI ASST 5 cut(s) 50, 214, 249, 262, 277
SinI GGWCC 1 cut(s) 98
Sse9I AATT 3 cut(s) 105, 138, 196
SsiI CCGC 2 cut(s) 68, 96
SspI AATATT 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 112
TaqI TCGA 2 cut(s) 51, 103
TasI AATT 3 cut(s) 105, 138, 196
TfiI GAWTC 2 cut(s) 171, 220
Tru1I TTAA 1 cut(s) 277
Tru9I TTAA 1 cut(s) 277
TspDTI ATGAA 2 cut(s) 17, 233
Van91I CCANNNNNTGG 1 cut(s) 236
VpaK11BI GGWCC 1 cut(s) 98
XapI RAATTY 2 cut(s) 105, 138
XmnI GAANNNNTTC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.