Rmu_sc0001729.1_g000012

Protein of unknown function (DUF1517)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001729.1
OG0000368
Physical Location & Seq
Reverse (-)
61129 .. 61470
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001729.1_g000012.1.cds

Sequence Viewer

Length: 342 bp
atggcgttgagaaatccggccaccgtcgccgcgttattgctcgctctgctattgatttcccaccccaatttcgcgtccgccgctacgggtgggcggtccggcggaagcctgttcccctccggcggagattcttcttcatcttcgtcttcgtcttcatcgtggtcggggtcttcgggtgcatcggactcttggtcgtggcaccactcgccgtcatcgtcgtcttccttgtcggacggtggattctacgtcttcttggttttaatggcggttgtggttggtgtggcggtcatctgccgctgtgctggtgttgggaaaacaagcgtcgtcaagcttcaggtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1517

Protein Analysis

113

Amino Acids

11.22

Weight (kDa)

8.84

Isoelectric Point (pI)

61.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000368)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G54520
fragaria_vesca FvH4_4g09430 FvH4_5g29750 FvH4_6g03490 FvH4_6g03500 FvH4_6g03510 FvH4_6g03510 FvH4_6g03510 FvH4_6g03520 FvH4_6g03530 FvH4_6g03530 FvH4_6g03530
malus_domestica MD04G1220400.v1.1 MD12G1236800.v1.1
prunus_persica Prupe.6G339400_v2.0.a1 Prupe.6G339400_v2.0.a1
pyrus_communis pycom04g19510 pycom12g21790
rosa_chinensis RchiOBHm_Chr3g0451981 RchiOBHm_Chr3g0451991 RchiOBHm_Chr3g0452001 RchiOBHm_Chr3g0452011 RchiOBHm_Chr3g0452041 RchiOBHm_Chr3g0452111 RchiOBHm_Chr3g0452121
rosa_laevigata RLG00000009056 RLG00000025627 RLG00000025628 RLG00000025630 RLG00000025631 RLG00000025632 RLG00000035582
rosa_multiflora Rmu_co8213316.1_g000001 Rmu_co8226081.1_g000001 Rmu_co8290691.1_g000001 Rmu_sc0001358.1_g000002 Rmu_sc0001358.1_g000004 Rmu_sc0001358.1_g000008 Rmu_sc0001358.1_g000011 Rmu_sc0001448.1_g000001 Rmu_sc0001448.1_g000005 Rmu_sc0001448.1_g000009 Rmu_sc0001729.1_g000006 Rmu_sc0001729.1_g000012 Rmu_sc0001729.1_g000017
rosa_roxburghii Rroxscaffold_164G00436060 Rroxscaffold_164G00436070 Rroxscaffold_164G00436100 Rroxscaffold_164G00436110 Rroxscaffold_164G00436120 Rroxscaffold_164G00436130 Rroxscaffold_4G00296230 Rroxscaffold_6G00389530 Rroxscaffold_6G00429160 Rroxscaffold_6G00429170 Rroxscaffold_6G00429200 Rroxscaffold_6G00429220 Rroxscaffold_6G00429240
rosa_rugosa Rorug01G0052400 Rorug01G0052500 Rorug02G0637900 Rorug02G0637900 Rorug02G0638000 Rorug02G0638100 Rorug02G0638100 Rorug02G0638100 Rorug02G0638100 Rorug02G0638200 Rorug02G0638300 Rorug02G0638400 Rorug04G0037400
rosa_samantha Rh2DG349300 Rh3AG039600 Rh3AG039700 Rh3AG039800 Rh3AG039900 Rh3AG040200 Rh3AG040300 Rh3BG041100 Rh3BG041200 Rh3BG041300 Rh3BG041500 Rh3BG041700 Rh3BG041800 Rh3CG039500 Rh3CG039600 Rh3CG039700 Rh3CG039800 Rh3CG040000 Rh3CG040200 Rh3DG040200 Rh3DG040400 Rh3DG040500 Rh3DG041000 Rh3DG041100 Rh4BG107500 Rh6BG085400 Rh6DG400800
rosa_wichuraiana Rw0G023520 Rw3G002980 Rw3G002990 Rw3G003010 Rw3G003030 Rw3G003040 Rw3G003060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 198
AccII CGCG 2 cut(s) 32, 74
AciI CCGC 9 cut(s) 30, 78, 81, 94, 102, 123, 266, 284, 295
AcoI YGGCCR 1 cut(s) 18
AcuI CTGAAG 1 cut(s) 317
AfiI CCNNNNNNNGG 1 cut(s) 122
AhdI GACNNNNNGTC 1 cut(s) 190
AluBI AGCT 1 cut(s) 331
AluI AGCT 1 cut(s) 331
AoxI GGCC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 96
AvaII GGWCC 1 cut(s) 96
BanI GGYRCC 1 cut(s) 198
BbsI GAAGAC 5 cut(s) 138, 144, 162, 213, 241
BceAI ACGGC 1 cut(s) 193
BisI GCNGC 3 cut(s) 30, 81, 295
BlsI GCNGC 3 cut(s) 31, 82, 296
Bme18I GGWCC 1 cut(s) 96
BmeRI GACNNNNNGTC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 200
BmsI GCATC 1 cut(s) 188
BpiI GAAGAC 5 cut(s) 138, 144, 162, 213, 241
Bsc4I CCNNNNNNNGG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 122
Bsh1236I CGCG 2 cut(s) 32, 74
BshFI GGCC 1 cut(s) 20
BshNI GGYRCC 1 cut(s) 198
BsiSI CCGG 3 cut(s) 17, 99, 120
BslI CCNNNNNNNGG 1 cut(s) 122
BsnI GGCC 1 cut(s) 20
BspACI CCGC 9 cut(s) 30, 78, 81, 94, 102, 123, 266, 284, 295
BspANI GGCC 1 cut(s) 20
BspFNI CGCG 2 cut(s) 32, 74
BspLI GGNNCC 1 cut(s) 200
BspT107I GGYRCC 1 cut(s) 198
Bst4CI ACNGT 2 cut(s) 25, 236
BstC8I GCNNGC 1 cut(s) 42
BstFNI CGCG 2 cut(s) 32, 74
BstMWI GCNNNNNNNGC 4 cut(s) 26, 46, 80, 205
BstUI CGCG 2 cut(s) 32, 74
BstV2I GAAGAC 5 cut(s) 138, 144, 162, 213, 241
BsuRI GGCC 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 96
CpoI CGGWCCG 1 cut(s) 96
CseI GACGC 2 cut(s) 63, 310
CspI CGGWCCG 1 cut(s) 96
CviJI RGCY 3 cut(s) 20, 108, 331
CviKI_1 RGCY 3 cut(s) 20, 108, 331
DriI GACNNNNNGTC 1 cut(s) 190
EaeI YGGCCR 1 cut(s) 18
Eam1105I GACNNNNNGTC 1 cut(s) 190
EciI GGCGGA 3 cut(s) 67, 117, 138
Eco47I GGWCC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 317
FaiI YATR 1 cut(s) 340
Fnu4HI GCNGC 3 cut(s) 30, 81, 295
Fsp4HI GCNGC 3 cut(s) 30, 81, 295
GluI GCNGC 3 cut(s) 30, 81, 295
HaeIII GGCC 1 cut(s) 20
HapII CCGG 3 cut(s) 17, 99, 120
HgaI GACGC 2 cut(s) 63, 310
HindIII AAGCTT 1 cut(s) 329
HinfI GANTC 3 cut(s) 128, 185, 240
HpaII CCGG 3 cut(s) 17, 99, 120
Hpy188I TCNGA 2 cut(s) 184, 232
Hpy99I CGWCG 3 cut(s) 29, 220, 326
HpyCH4III ACNGT 2 cut(s) 25, 236
HpyCH4IV ACGT 1 cut(s) 246
HpyCH4V TGCA 1 cut(s) 179
HpyF10VI GCNNNNNNNGC 4 cut(s) 26, 46, 80, 205
HpySE526I ACGT 1 cut(s) 246
LpnPI CCDG 6 cut(s) 30, 112, 122, 133, 288, 320
LweI GCATC 1 cut(s) 188
MaeII ACGT 1 cut(s) 246
MboII GAAGA 8 cut(s) 123, 126, 132, 138, 144, 162, 213, 241
MluCI AATT 1 cut(s) 67
MlyI GAGTC 1 cut(s) 179
MmeI TCCRAC 1 cut(s) 210
MnlI CCTC 1 cut(s) 127
MseI TTAA 1 cut(s) 260
MspA1I CMGCKG 1 cut(s) 297
MspI CCGG 3 cut(s) 17, 99, 120
MvnI CGCG 2 cut(s) 32, 74
MwoI GCNNNNNNNGC 4 cut(s) 26, 46, 80, 205
NlaIV GGNNCC 1 cut(s) 200
PcsI WCGNNNNNNNCGW 2 cut(s) 155, 212
PfeI GAWTC 2 cut(s) 128, 240
PkrI GCNGC 3 cut(s) 31, 82, 296
PleI GAGTC 1 cut(s) 179
PpsI GAGTC 1 cut(s) 179
PspN4I GGNNCC 1 cut(s) 200
PspPI GGNCC 1 cut(s) 96
Rsr2I CGGWCCG 1 cut(s) 96
RsrII CGGWCCG 1 cut(s) 96
SaqAI TTAA 1 cut(s) 260
SatI GCNGC 3 cut(s) 30, 81, 295
Sau96I GGNCC 1 cut(s) 96
SchI GAGTC 1 cut(s) 179
SetI ASST 3 cut(s) 249, 333, 339
SfaNI GCATC 1 cut(s) 188
SinI GGWCC 1 cut(s) 96
Sse9I AATT 1 cut(s) 67
SsiI CCGC 9 cut(s) 30, 78, 81, 94, 102, 123, 266, 284, 295
TaaI ACNGT 2 cut(s) 25, 236
TaiI ACGT 1 cut(s) 249
TasI AATT 1 cut(s) 67
TauI GCSGC 3 cut(s) 32, 83, 297
TfiI GAWTC 2 cut(s) 128, 240
Tru1I TTAA 1 cut(s) 260
Tru9I TTAA 1 cut(s) 260
TspDTI ATGAA 2 cut(s) 126, 144
VpaK11BI GGWCC 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.