Rh3DG040200

Protein of unknown function (DUF1517)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0000368
Physical Location & Seq
Reverse (-)
2633234 .. 2633514
281 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG040200.1

Sequence Viewer

Length: 168 bp
ATGTTACCCAGCGTCAATAGCAGTCCTGAGTTGAAGGAAGCACTGCAGAAACTTTCATCTATCGAAAGACTACGGGCAGTTGAAGTGTTGTGGACTCCTCAGAATGAAACAAACACTCTGTTAGAGGAGCAACTGCTTAAAAGTTACCCACACTTGAAGCACTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1517

Protein Analysis

55

Amino Acids

6.39

Weight (kDa)

6.05

Isoelectric Point (pI)

56.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1517 PF07466 2 - 54 1.3e-14 Protein of unknown function (DUF1517)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000368)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G54520
fragaria_vesca FvH4_4g09430 FvH4_5g29750 FvH4_6g03490 FvH4_6g03500 FvH4_6g03510 FvH4_6g03510 FvH4_6g03510 FvH4_6g03520 FvH4_6g03530 FvH4_6g03530 FvH4_6g03530
malus_domestica MD04G1220400.v1.1 MD12G1236800.v1.1
prunus_persica Prupe.6G339400_v2.0.a1 Prupe.6G339400_v2.0.a1
pyrus_communis pycom04g19510 pycom12g21790
rosa_chinensis RchiOBHm_Chr3g0451981 RchiOBHm_Chr3g0451991 RchiOBHm_Chr3g0452001 RchiOBHm_Chr3g0452011 RchiOBHm_Chr3g0452041 RchiOBHm_Chr3g0452111 RchiOBHm_Chr3g0452121
rosa_laevigata RLG00000009056 RLG00000025627 RLG00000025628 RLG00000025630 RLG00000025631 RLG00000025632 RLG00000035582
rosa_multiflora Rmu_co8213316.1_g000001 Rmu_co8226081.1_g000001 Rmu_co8290691.1_g000001 Rmu_sc0001358.1_g000002 Rmu_sc0001358.1_g000004 Rmu_sc0001358.1_g000008 Rmu_sc0001358.1_g000011 Rmu_sc0001448.1_g000001 Rmu_sc0001448.1_g000005 Rmu_sc0001448.1_g000009 Rmu_sc0001729.1_g000006 Rmu_sc0001729.1_g000012 Rmu_sc0001729.1_g000017
rosa_roxburghii Rroxscaffold_164G00436060 Rroxscaffold_164G00436070 Rroxscaffold_164G00436100 Rroxscaffold_164G00436110 Rroxscaffold_164G00436120 Rroxscaffold_164G00436130 Rroxscaffold_4G00296230 Rroxscaffold_6G00389530 Rroxscaffold_6G00429160 Rroxscaffold_6G00429170 Rroxscaffold_6G00429200 Rroxscaffold_6G00429220 Rroxscaffold_6G00429240
rosa_rugosa Rorug01G0052400 Rorug01G0052500 Rorug02G0637900 Rorug02G0637900 Rorug02G0638000 Rorug02G0638100 Rorug02G0638100 Rorug02G0638100 Rorug02G0638100 Rorug02G0638200 Rorug02G0638300 Rorug02G0638400 Rorug04G0037400
rosa_samantha Rh2DG349300 Rh3AG039600 Rh3AG039700 Rh3AG039800 Rh3AG039900 Rh3AG040200 Rh3AG040300 Rh3BG041100 Rh3BG041200 Rh3BG041300 Rh3BG041500 Rh3BG041700 Rh3BG041800 Rh3CG039500 Rh3CG039600 Rh3CG039700 Rh3CG039800 Rh3CG040000 Rh3CG040200 Rh3DG040200 Rh3DG040400 Rh3DG040500 Rh3DG041000 Rh3DG041100 Rh4BG107500 Rh6BG085400 Rh6DG400800
rosa_wichuraiana Rw0G023520 Rw3G002980 Rw3G002990 Rw3G003010 Rw3G003030 Rw3G003040 Rw3G003060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 34, 83, 157
BfmI CTRYAG 1 cut(s) 44
BseMII CTCAG 2 cut(s) 18, 113
BseRI GAGGAG 2 cut(s) 87, 140
BseYI CCCAGC 1 cut(s) 8
BspCNI CTCAG 2 cut(s) 19, 112
BspMAI CTGCAG 1 cut(s) 48
BstDEI CTNAG 2 cut(s) 27, 99
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 44
BtsI GCAGTG 1 cut(s) 41
BtsIMutI CAGTG 1 cut(s) 41
DdeI CTNAG 2 cut(s) 27, 99
GsaI CCCAGC 1 cut(s) 12
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 26
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 27, 99
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 22, 39
MaeIII GTNAC 2 cut(s) 3, 143
MlyI GAGTC 1 cut(s) 88
MnlI CCTC 2 cut(s) 108, 118
MseI TTAA 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 18
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PspFI CCCAGC 1 cut(s) 8
PstI CTGCAG 1 cut(s) 48
SaqAI TTAA 1 cut(s) 138
SchI GAGTC 1 cut(s) 88
SfcI CTRYAG 1 cut(s) 44
SgeI CNNG 3 cut(s) 21, 38, 86
TaqI TCGA 1 cut(s) 63
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 45, 120
TspRI CASTG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.