Rmu_sc0008509.1_g000002
ERF Family

Belongs to the protein kinase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008509.1
OG0000416
Physical Location & Seq
Forward (+)
12125 .. 13915
1791 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008509.1_g000002.1.cds

Sequence Viewer

Length: 690 bp
atgcctaataggagcttagaggatcatcttttcaacagggctttgaaccctcttccttggatcacgaggttacaaataatgcttggtgctgctcaaggattggcttatttacacgagggactggaagtccaggtgatatatcgagatttcaaatcctccaacgtgctcttggatgaggactttaagccgaagctctcagacttcgggcttgctagagaagggccaaagggtgaccgtactcatgtatcgacagcagtggtagggacttatggatatgctgccccagagtatgttgaaacaggccatctttccatccatagtgacttgtggagttttggtgtggtgctgtatgagatcctcactgggaggcgtgtcttagagagacaccggccaacagcggagcagaagcttctttattgggttagacagtaccctgcagacagtaaaaagtttagcatgataatagatccactcctgagagaccagtattctattaatgcagctcagaaaattgccaagttggcagatagctgcctgaacaagaatgcaaaagaccggccaacaatgaatcaggtggtagagatcttgaagcaagctatacaagattcacaaaagggtactaactctgtaaataacaattttggggcatctgggtctaaattgggtagaacgaaccccaagttgaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

229

Amino Acids

25.83

Weight (kDa)

9.34

Isoelectric Point (pI)

27.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000416)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G47070
fragaria_vesca FvH4_5g20770 FvH4_5g20770 FvH4_5g20770 FvH4_5g20770 FvH4_7g08930 FvH4_7g08930 FvH4_7g08930 FvH4_7g08930 FvH4_7g08930
malus_domestica MD02G1222400.v1.1 MD04G1053100.v1.1 MD06G1044400.v1.1 MD07G1093200.v1.1
prunus_persica Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.5G052200_v2.0.a1 Prupe.5G052200_v2.0.a1
pyrus_communis pycom02g18890 pycom04g04660 pycom06g03780 pycom07g07640
rosa_chinensis RchiOBHm_Chr0c22g0500461 RchiOBHm_Chr0c22g0500491 RchiOBHm_Chr0c22g0500531 RchiOBHm_Chr0c22g0500541 RchiOBHm_Chr0c22g0500641 RchiOBHm_Chr0c22g0500691 RchiOBHm_Chr1g0344381 RchiOBHm_Chr6g0259661 RchiOBHm_Chr6g0259701 RchiOBHm_Chr7g0205471 RchiOBHm_Chr7g0206561 RchiOBHm_Chr7g0206611 RchiOBHm_Chr7g0206731 RchiOBHm_Chr7g0206741 RchiOBHm_Chr7g0206781 RchiOBHm_Chr7g0206801 RchiOBHm_Chr7g0206811 RchiOBHm_Chr7g0206831 RchiOBHm_Chr7g0206861 RchiOBHm_Chr7g0206891 RchiOBHm_Chr7g0206981 RchiOBHm_Chr7g0206991 RchiOBHm_Chr7g0207071 RchiOBHm_Chr7g0207121 RchiOBHm_Chr7g0207151 RchiOBHm_Chr7g0207181 RchiOBHm_Chr7g0207241 RchiOBHm_Chr7g0207251 RchiOBHm_Chr7g0207261 RchiOBHm_Chr7g0207411 RchiOBHm_Chr7g0207471 RchiOBHm_Chr7g0207701
rosa_laevigata RLG00000003296 RLG00000003302 RLG00000003326 RLG00000003346 RLG00000028901
rosa_multiflora Rmu_sc0000536.1_g000001 Rmu_sc0000536.1_g000002 Rmu_sc0004987.1_g000003 Rmu_sc0008509.1_g000002 Rmu_sc0008509.1_g000029 Rmu_sc0012558.1_g000001 Rmu_sc0013160.1_g000002 Rmu_sc0014912.1_g000004
rosa_roxburghii Rroxscaffold_3G00251310 Rroxscaffold_3G00251320 Rroxscaffold_3G00251410 Rroxscaffold_3G00252190 Rroxscaffold_4G00309810 Rroxscaffold_7G00206970 Rroxscaffold_7G00207090
rosa_rugosa Rorug01G0173500 Rorug01G0173600 Rorug05G0590200 Rorug07G0096400 Rorug07G0096700 Rorug07G0096900 Rorug07G0098500 Rorug07G0099000
rosa_samantha Rh1AG189700 Rh1BG156700 Rh1DG188100 Rh7BG221600 Rh7BG225000 Rh7BG225300 Rh7BG227500 Rh7BG227700 Rh7CG244800
rosa_wichuraiana Rw1G015650 Rw6G009210 Rw7G019820 Rw7G019850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 398
AclWI GGATC 4 cut(s) 30, 68, 349, 461
AcoI YGGCCR 2 cut(s) 389, 557
AfaI GTAC 3 cut(s) 238, 431, 619
AfiI CCNNNNNNNGG 1 cut(s) 684
AgsI TTSAA 5 cut(s) 34, 46, 151, 296, 589
AhdI GACNNNNNGTC 1 cut(s) 125
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 6 cut(s) 15, 193, 409, 503, 531, 596
AluI AGCT 6 cut(s) 15, 193, 409, 503, 531, 596
Alw21I GWGCWC 1 cut(s) 168
Alw26I GTCTC 2 cut(s) 376, 474
AlwI GGATC 4 cut(s) 30, 68, 349, 461
AoxI GGCC 4 cut(s) 221, 301, 389, 557
ApeKI GCWGC 4 cut(s) 89, 278, 500, 531
AseI ATTAAT 1 cut(s) 495
AspS9I GGNCC 1 cut(s) 221
AsuHPI GGTGA 2 cut(s) 145, 242
BaeI ACNNNNGTAYC 2 cut(s) 228, 261
BauI CACGAG 2 cut(s) 64, 113
Bbv12I GWGCWC 1 cut(s) 168
BbvI GCAGC 4 cut(s) 76, 265, 512, 518
BccI CCATC 2 cut(s) 312, 320
BciT130I CCWGG 1 cut(s) 131
BcoDI GTCTC 2 cut(s) 376, 474
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 435
BglI GCCNNNNNGGC 1 cut(s) 521
BglII AGATCT 1 cut(s) 582
BisI GCNGC 4 cut(s) 90, 279, 501, 532
BlsI GCNGC 4 cut(s) 91, 280, 502, 533
Bme1390I CCNGG 1 cut(s) 131
BmeRI GACNNNNNGTC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 131
BmrI ACTGGG 1 cut(s) 372
BmsI GCATC 1 cut(s) 656
BmuI ACTGGG 1 cut(s) 372
BpuEI CTTGAG 1 cut(s) 78
BsaI GGTCTC 1 cut(s) 474
BsaJI CCNNGG 1 cut(s) 56
BsaXI ACNNNNNCTCC 2 cut(s) 322, 352
Bsc4I CCNNNNNNNGG 1 cut(s) 684
Bse118I RCCGGY 2 cut(s) 387, 555
Bse1I ACTGG 3 cut(s) 126, 367, 484
BseBI CCWGG 1 cut(s) 131
BseDI CCNNGG 1 cut(s) 56
BseGI GGATG 2 cut(s) 178, 312
BseLI CCNNNNNNNGG 1 cut(s) 684
BseMII CTCAG 3 cut(s) 210, 467, 518
BseNI ACTGG 3 cut(s) 126, 367, 484
BseXI GCAGC 4 cut(s) 76, 265, 512, 518
BshFI GGCC 4 cut(s) 223, 303, 391, 559
BsiHKAI GWGCWC 1 cut(s) 168
BsiSI CCGG 2 cut(s) 388, 556
BslFI GGGAC 2 cut(s) 132, 277
BslI CCNNNNNNNGG 1 cut(s) 684
BsmAI GTCTC 2 cut(s) 376, 474
BsmFI GGGAC 2 cut(s) 132, 277
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 4 cut(s) 223, 303, 391, 559
Bso31I GGTCTC 1 cut(s) 474
Bsp1286I GDGCHC 1 cut(s) 168
Bsp143I GATC 5 cut(s) 22, 60, 354, 466, 582
BspACI CCGC 1 cut(s) 398
BspANI GGCC 4 cut(s) 223, 303, 391, 559
BspCNI CTCAG 3 cut(s) 209, 468, 517
BspMAI CTGCAG 1 cut(s) 439
BspPI GGATC 4 cut(s) 30, 68, 349, 461
BspTNI GGTCTC 1 cut(s) 474
BsrFI RCCGGY 2 cut(s) 387, 555
BsrI ACTGG 3 cut(s) 126, 367, 484
BssAI RCCGGY 2 cut(s) 387, 555
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 5 cut(s) 22, 60, 354, 466, 582
BssSI CACGAG 2 cut(s) 64, 113
BssT1I CCWWGG 1 cut(s) 56
Bst2BI CACGAG 2 cut(s) 64, 113
Bst2UI CCWGG 1 cut(s) 131
Bst4CI ACNGT 3 cut(s) 236, 429, 443
Bst6I CTCTTC 1 cut(s) 57
BstC8I GCNNGC 2 cut(s) 210, 594
BstDEI CTNAG 5 cut(s) 16, 196, 376, 476, 504
BstEII GGTNACC 1 cut(s) 230
BstF5I GGATG 2 cut(s) 178, 312
BstKTI GATC 5 cut(s) 25, 63, 357, 469, 585
BstMAI GTCTC 2 cut(s) 376, 474
BstMBI GATC 5 cut(s) 22, 60, 354, 466, 582
BstMWI GCNNNNNNNGC 1 cut(s) 521
BstNI CCWGG 1 cut(s) 131
BstPI GGTNACC 1 cut(s) 230
BstSCI CCNGG 1 cut(s) 129
BstSFI CTRYAG 1 cut(s) 435
BstV1I GCAGC 4 cut(s) 76, 265, 512, 518
BstX2I RGATCY 3 cut(s) 354, 466, 582
BstYI RGATCY 3 cut(s) 354, 466, 582
BsuRI GGCC 4 cut(s) 223, 303, 391, 559
BtsCI GGATG 2 cut(s) 178, 312
BtsI GCAGTG 1 cut(s) 261
BtsIMutI CAGTG 2 cut(s) 261, 360
Cac8I GCNNGC 2 cut(s) 210, 594
Cfr10I RCCGGY 2 cut(s) 387, 555
Cfr13I GGNCC 1 cut(s) 221
Csp6I GTAC 3 cut(s) 237, 430, 618
CviAII CATG 2 cut(s) 242, 457
CviQI GTAC 3 cut(s) 237, 430, 618
DdeI CTNAG 5 cut(s) 16, 196, 376, 476, 504
DpnI GATC 5 cut(s) 24, 62, 356, 468, 584
DpnII GATC 5 cut(s) 22, 60, 354, 466, 582
DriI GACNNNNNGTC 1 cut(s) 125
EaeI YGGCCR 2 cut(s) 389, 557
Eam1104I CTCTTC 1 cut(s) 57
Eam1105I GACNNNNNGTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 56
Eco31I GGTCTC 1 cut(s) 474
Eco91I GGTNACC 1 cut(s) 230
EcoO65I GGTNACC 1 cut(s) 230
EcoRII CCWGG 1 cut(s) 129
EcoT14I CCWWGG 1 cut(s) 56
ErhI CCWWGG 1 cut(s) 56
FaeI CATG 2 cut(s) 245, 460
FaiI YATR 9 cut(s) 139, 243, 270, 276, 291, 318, 351, 458, 599
FaqI GGGAC 2 cut(s) 132, 277
FatI CATG 2 cut(s) 241, 456
Fnu4HI GCNGC 4 cut(s) 90, 279, 501, 532
FokI GGATG 2 cut(s) 185, 299
Fsp4HI GCNGC 4 cut(s) 90, 279, 501, 532
FspBI CTAG 1 cut(s) 213
GluI GCNGC 4 cut(s) 90, 279, 501, 532
HaeIII GGCC 4 cut(s) 223, 303, 391, 559
HapII CCGG 2 cut(s) 388, 556
Hin1II CATG 2 cut(s) 245, 460
HindIII AAGCTT 1 cut(s) 407
HinfI GANTC 2 cut(s) 568, 605
HpaII CCGG 2 cut(s) 388, 556
HphI GGTGA 2 cut(s) 145, 242
Hpy188I TCNGA 2 cut(s) 199, 507
Hpy188III TCNNGA 4 cut(s) 64, 143, 475, 586
HpyAV CCTTC 1 cut(s) 212
HpyCH4III ACNGT 3 cut(s) 236, 429, 443
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 3 cut(s) 437, 500, 548
HpyF10VI GCNNNNNNNGC 1 cut(s) 521
HpyF3I CTNAG 5 cut(s) 16, 196, 376, 476, 504
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 2 cut(s) 245, 460
Kzo9I GATC 5 cut(s) 22, 60, 354, 466, 582
LmnI GCTCC 2 cut(s) 12, 400
Lsp1109I GCAGC 4 cut(s) 76, 265, 512, 518
LweI GCATC 1 cut(s) 656
MaeI CTAG 1 cut(s) 213
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 3 cut(s) 69, 230, 320
MalI GATC 5 cut(s) 24, 62, 356, 468, 584
MboI GATC 5 cut(s) 22, 60, 354, 466, 582
MboII GAAGA 1 cut(s) 44
MflI RGATCY 3 cut(s) 354, 466, 582
MhlI GDGCHC 1 cut(s) 168
MluCI AATT 3 cut(s) 510, 637, 659
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 9 cut(s) 13, 60, 60, 109, 166, 169, 360, 368, 678
MseI TTAA 2 cut(s) 183, 495
MspA1I CMGCKG 1 cut(s) 398
MspI CCGG 2 cut(s) 388, 556
MspR9I CCNGG 1 cut(s) 131
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 1 cut(s) 131
MwoI GCNNNNNNNGC 1 cut(s) 521
NdeII GATC 5 cut(s) 22, 60, 354, 466, 582
NlaIII CATG 2 cut(s) 245, 460
NmuCI GTSAC 2 cut(s) 230, 320
PctI GAATGC 1 cut(s) 550
PfeI GAWTC 2 cut(s) 568, 605
PkrI GCNGC 4 cut(s) 91, 280, 502, 533
PshBI ATTAAT 1 cut(s) 495
Psp6I CCWGG 1 cut(s) 129
PspEI GGTNACC 1 cut(s) 230
PspGI CCWGG 1 cut(s) 129
PspPI GGNCC 1 cut(s) 221
PstI CTGCAG 1 cut(s) 439
PsuI RGATCY 3 cut(s) 354, 466, 582
RsaI GTAC 3 cut(s) 238, 431, 619
RsaNI GTAC 3 cut(s) 237, 430, 618
SaqAI TTAA 2 cut(s) 183, 495
SatI GCNGC 4 cut(s) 90, 279, 501, 532
Sau3AI GATC 5 cut(s) 22, 60, 354, 466, 582
Sau96I GGNCC 1 cut(s) 221
ScrFI CCNGG 1 cut(s) 131
SduI GDGCHC 1 cut(s) 168
SfaNI GCATC 1 cut(s) 656
SfcI CTRYAG 1 cut(s) 435
SmlI CTYRAG 1 cut(s) 93
SmoI CTYRAG 1 cut(s) 93
Sse9I AATT 3 cut(s) 510, 637, 659
SsiI CCGC 1 cut(s) 398
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 129
StyI CCWWGG 1 cut(s) 56
TaaI ACNGT 3 cut(s) 236, 429, 443
TaiI ACGT 1 cut(s) 165
TaqI TCGA 2 cut(s) 142, 248
TasI AATT 3 cut(s) 510, 637, 659
TfiI GAWTC 2 cut(s) 568, 605
Tru1I TTAA 2 cut(s) 183, 495
Tru9I TTAA 2 cut(s) 183, 495
TscAI CASTG 2 cut(s) 261, 367
TseFI GTSAC 2 cut(s) 230, 320
TseI GCWGC 4 cut(s) 89, 278, 500, 531
Tsp45I GTSAC 2 cut(s) 230, 320
TspDTI ATGAA 1 cut(s) 581
TspRI CASTG 2 cut(s) 261, 367
VspI ATTAAT 1 cut(s) 495
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.