Rmu_sc0013160.1_g000002
ERF Family

Belongs to the protein kinase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013160.1
OG0000416
Physical Location & Seq
Reverse (-)
6552 .. 11566
5015 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013160.1_g000002.1.cds

Sequence Viewer

Length: 1143 bp
atgatcccatctgggctaggaagatcgttttcctgtggtgtttgggttcccgagggattcaaccaatggcttcagcaggttgcaaaagcttggggaaggaggcttccaccaagaagcataccagaattgtacaaagagaaggagcagaatttgaaggttttctcactccaagagctcagggattcaactaatggcttcagcaggttgcaaaagcttggtgaaggaggcttcgggagtgtgtataaaggaataatcaagcccaaaaatggcaagggtactccaattttggttgccataaagaagttgaatccacatagcttacagggtcataaagaatggcttgcagaggttcaatttcttggtgtggtaaatcacccaaatctggtaaagcttctaggatattgctctgtagatggagaaagagggatccaacggctattggtatatgaatatatgcctaataggagcttagaggatcatcttttcaacagggctttgaaccctcttccttggatcacgaggttacaaataatgctgggtgctgctcaaggattggcttatttacacgagggactggaagtccaggtgatatatcgagatttcaaatcctccaatgtgctcttggatgaggactttaagccgaagctctcagacttcgggcttgctagagaagggccaaagggtgaccgtactcatgtatcgacagcagtggtagggacttatggatatgctgcccccgagtatgttgaaacaggccatctttccgtccatagtgacttatggagttttggtgtggtgctgtatgagatcctcactgggaggcgtgtcttagaaagacaccggccaacagcggagcagaagcttctttattgggttagacagtaccctgcagacagtaaaaagtttagcatgataatagatccactcctgagagaccaatattctattactgcagctcggaaaattgccaagttggcagatagctgcctgaacaagaatgcaaaagaccggccaacaatgaatcaggtagtagagatcttgaagcaatctatagaagattcacaaaagggtactaactctgtaaataacaattttggggcatctgggtctaaattgggtagaaagaaccccaagttgaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

380

Amino Acids

42.84

Weight (kDa)

9.61

Isoelectric Point (pI)

32.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000416)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G47070
fragaria_vesca FvH4_5g20770 FvH4_5g20770 FvH4_5g20770 FvH4_5g20770 FvH4_7g08930 FvH4_7g08930 FvH4_7g08930 FvH4_7g08930 FvH4_7g08930
malus_domestica MD02G1222400.v1.1 MD04G1053100.v1.1 MD06G1044400.v1.1 MD07G1093200.v1.1
prunus_persica Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.2G118500_v2.0.a1 Prupe.5G052200_v2.0.a1 Prupe.5G052200_v2.0.a1
pyrus_communis pycom02g18890 pycom04g04660 pycom06g03780 pycom07g07640
rosa_chinensis RchiOBHm_Chr0c22g0500461 RchiOBHm_Chr0c22g0500491 RchiOBHm_Chr0c22g0500531 RchiOBHm_Chr0c22g0500541 RchiOBHm_Chr0c22g0500641 RchiOBHm_Chr0c22g0500691 RchiOBHm_Chr1g0344381 RchiOBHm_Chr6g0259661 RchiOBHm_Chr6g0259701 RchiOBHm_Chr7g0205471 RchiOBHm_Chr7g0206561 RchiOBHm_Chr7g0206611 RchiOBHm_Chr7g0206731 RchiOBHm_Chr7g0206741 RchiOBHm_Chr7g0206781 RchiOBHm_Chr7g0206801 RchiOBHm_Chr7g0206811 RchiOBHm_Chr7g0206831 RchiOBHm_Chr7g0206861 RchiOBHm_Chr7g0206891 RchiOBHm_Chr7g0206981 RchiOBHm_Chr7g0206991 RchiOBHm_Chr7g0207071 RchiOBHm_Chr7g0207121 RchiOBHm_Chr7g0207151 RchiOBHm_Chr7g0207181 RchiOBHm_Chr7g0207241 RchiOBHm_Chr7g0207251 RchiOBHm_Chr7g0207261 RchiOBHm_Chr7g0207411 RchiOBHm_Chr7g0207471 RchiOBHm_Chr7g0207701
rosa_laevigata RLG00000003296 RLG00000003302 RLG00000003326 RLG00000003346 RLG00000028901
rosa_multiflora Rmu_sc0000536.1_g000001 Rmu_sc0000536.1_g000002 Rmu_sc0004987.1_g000003 Rmu_sc0008509.1_g000002 Rmu_sc0008509.1_g000029 Rmu_sc0012558.1_g000001 Rmu_sc0013160.1_g000002 Rmu_sc0014912.1_g000004
rosa_roxburghii Rroxscaffold_3G00251310 Rroxscaffold_3G00251320 Rroxscaffold_3G00251410 Rroxscaffold_3G00252190 Rroxscaffold_4G00309810 Rroxscaffold_7G00206970 Rroxscaffold_7G00207090
rosa_rugosa Rorug01G0173500 Rorug01G0173600 Rorug05G0590200 Rorug07G0096400 Rorug07G0096700 Rorug07G0096900 Rorug07G0098500 Rorug07G0099000
rosa_samantha Rh1AG189700 Rh1BG156700 Rh1DG188100 Rh7BG221600 Rh7BG225000 Rh7BG225300 Rh7BG227500 Rh7BG227700 Rh7CG244800
rosa_wichuraiana Rw1G015650 Rw6G009210 Rw7G019820 Rw7G019850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 67, 192
AciI CCGC 1 cut(s) 851
AclWI GGATC 6 cut(s) 421, 434, 483, 521, 802, 914
AcoI YGGCCR 2 cut(s) 842, 1010
AcsI RAATTY 1 cut(s) 148
AcuI CTGAAG 2 cut(s) 56, 181
AfaI GTAC 5 cut(s) 131, 277, 691, 884, 1072
AfiI CCNNNNNNNGG 3 cut(s) 266, 382, 1137
AhdI GACNNNNNGTC 1 cut(s) 578
AjnI CCWGG 1 cut(s) 582
Alw21I GWGCWC 2 cut(s) 177, 621
Alw26I GTCTC 1 cut(s) 927
AlwI GGATC 6 cut(s) 421, 434, 483, 521, 802, 914
Ama87I CYCGRG 2 cut(s) 50, 737
AoxI GGCC 4 cut(s) 674, 754, 842, 1010
ApeKI GCWGC 4 cut(s) 542, 731, 953, 984
ApoI RAATTY 1 cut(s) 148
Asp700I GAANNNNTTC 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 674
AsuHPI GGTGA 4 cut(s) 230, 365, 598, 695
AvaI CYCGRG 2 cut(s) 50, 737
BaeI ACNNNNGTAYC 2 cut(s) 681, 714
BamHI GGATCC 1 cut(s) 426
BanII GRGCYC 1 cut(s) 177
BauI CACGAG 2 cut(s) 517, 566
Bbv12I GWGCWC 2 cut(s) 177, 621
BbvI GCAGC 4 cut(s) 529, 718, 965, 971
BccI CCATC 3 cut(s) 16, 407, 765
BceAI ACGGC 1 cut(s) 449
BciT130I CCWGG 1 cut(s) 584
BcoDI GTCTC 1 cut(s) 927
BfaI CTAG 3 cut(s) 17, 395, 666
BfmI CTRYAG 4 cut(s) 408, 888, 951, 1050
BfuAI ACCTGC 2 cut(s) 67, 192
BglI GCCNNNNNGGC 1 cut(s) 974
BglII AGATCT 1 cut(s) 1035
BisI GCNGC 4 cut(s) 543, 732, 954, 985
BlsI GCNGC 4 cut(s) 544, 733, 955, 986
Bme1390I CCNGG 1 cut(s) 584
BmeRI GACNNNNNGTC 1 cut(s) 578
BmeT110I CYCGRG 2 cut(s) 50, 737
BmgT120I GGNCC 1 cut(s) 674
BmiI GGNNCC 2 cut(s) 48, 428
BmrFI CCNGG 1 cut(s) 584
BmrI ACTGGG 1 cut(s) 825
BmsI GCATC 1 cut(s) 1109
BmuI ACTGGG 1 cut(s) 825
Bpu10I CCTNAGC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 531
BsaI GGTCTC 1 cut(s) 927
BsaJI CCNNGG 2 cut(s) 51, 509
BsaXI ACNNNNNCTCC 2 cut(s) 775, 805
Bsc4I CCNNNNNNNGG 3 cut(s) 266, 382, 1137
Bse118I RCCGGY 2 cut(s) 840, 1008
Bse1I ACTGG 2 cut(s) 579, 820
BseBI CCWGG 1 cut(s) 584
BseDI CCNNGG 2 cut(s) 51, 509
BseGI GGATG 1 cut(s) 631
BseLI CCNNNNNNNGG 3 cut(s) 266, 382, 1137
BseMII CTCAG 3 cut(s) 190, 663, 920
BseNI ACTGG 2 cut(s) 579, 820
BseXI GCAGC 4 cut(s) 529, 718, 965, 971
BseYI CCCAGC 1 cut(s) 535
BshFI GGCC 4 cut(s) 676, 756, 844, 1012
BsiHKAI GWGCWC 2 cut(s) 177, 621
BsiHKCI CYCGRG 2 cut(s) 50, 737
BsiSI CCGG 2 cut(s) 841, 1009
BslFI GGGAC 2 cut(s) 585, 730
BslI CCNNNNNNNGG 3 cut(s) 266, 382, 1137
BsmAI GTCTC 1 cut(s) 927
BsmFI GGGAC 2 cut(s) 585, 730
BsmI GAATGC 1 cut(s) 1003
BsnI GGCC 4 cut(s) 676, 756, 844, 1012
Bso31I GGTCTC 1 cut(s) 927
BsoBI CYCGRG 2 cut(s) 50, 737
Bsp1286I GDGCHC 2 cut(s) 177, 621
Bsp1407I TGTACA 1 cut(s) 129
Bsp143I GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
BspACI CCGC 1 cut(s) 851
BspANI GGCC 4 cut(s) 676, 756, 844, 1012
BspCNI CTCAG 3 cut(s) 189, 662, 921
BspLI GGNNCC 2 cut(s) 48, 428
BspMAI CTGCAG 2 cut(s) 892, 955
BspMI ACCTGC 2 cut(s) 67, 192
BspPI GGATC 6 cut(s) 421, 434, 483, 521, 802, 914
BspTNI GGTCTC 1 cut(s) 927
BsrFI RCCGGY 2 cut(s) 840, 1008
BsrGI TGTACA 1 cut(s) 129
BsrI ACTGG 2 cut(s) 579, 820
BssAI RCCGGY 2 cut(s) 840, 1008
BssECI CCNNGG 2 cut(s) 51, 509
BssMI GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
BssSI CACGAG 2 cut(s) 517, 566
BssT1I CCWWGG 1 cut(s) 509
Bst2BI CACGAG 2 cut(s) 517, 566
Bst2UI CCWGG 1 cut(s) 584
Bst4CI ACNGT 3 cut(s) 689, 882, 896
Bst6I CTCTTC 1 cut(s) 510
BstAUI TGTACA 1 cut(s) 129
BstC8I GCNNGC 2 cut(s) 342, 663
BstDEI CTNAG 5 cut(s) 176, 469, 649, 829, 929
BstEII GGTNACC 1 cut(s) 683
BstF5I GGATG 1 cut(s) 631
BstKTI GATC 8 cut(s) 6, 26, 429, 478, 516, 810, 922, 1038
BstMAI GTCTC 1 cut(s) 927
BstMBI GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
BstMWI GCNNNNNNNGC 1 cut(s) 974
BstNI CCWGG 1 cut(s) 584
BstPI GGTNACC 1 cut(s) 683
BstSCI CCNGG 1 cut(s) 582
BstSFI CTRYAG 4 cut(s) 408, 888, 951, 1050
BstV1I GCAGC 4 cut(s) 529, 718, 965, 971
BstX2I RGATCY 4 cut(s) 426, 807, 919, 1035
BstYI RGATCY 4 cut(s) 426, 807, 919, 1035
BsuRI GGCC 4 cut(s) 676, 756, 844, 1012
BtsCI GGATG 1 cut(s) 631
BtsI GCAGTG 1 cut(s) 714
BtsIMutI CAGTG 2 cut(s) 714, 813
BveI ACCTGC 2 cut(s) 67, 192
Cac8I GCNNGC 2 cut(s) 342, 663
Cfr10I RCCGGY 2 cut(s) 840, 1008
Cfr13I GGNCC 1 cut(s) 674
Csp6I GTAC 5 cut(s) 130, 276, 690, 883, 1071
CviAII CATG 2 cut(s) 695, 910
CviQI GTAC 5 cut(s) 130, 276, 690, 883, 1071
DdeI CTNAG 5 cut(s) 176, 469, 649, 829, 929
DpnI GATC 8 cut(s) 5, 25, 428, 477, 515, 809, 921, 1037
DpnII GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
DriI GACNNNNNGTC 1 cut(s) 578
EaeI YGGCCR 2 cut(s) 842, 1010
Eam1104I CTCTTC 1 cut(s) 510
Eam1105I GACNNNNNGTC 1 cut(s) 578
EarI CTCTTC 1 cut(s) 510
Ecl136II GAGCTC 1 cut(s) 175
Eco130I CCWWGG 1 cut(s) 509
Eco24I GRGCYC 1 cut(s) 177
Eco31I GGTCTC 1 cut(s) 927
Eco53kI GAGCTC 1 cut(s) 175
Eco57I CTGAAG 2 cut(s) 56, 181
Eco88I CYCGRG 2 cut(s) 50, 737
Eco91I GGTNACC 1 cut(s) 683
EcoICRI GAGCTC 1 cut(s) 175
EcoO65I GGTNACC 1 cut(s) 683
EcoRII CCWGG 1 cut(s) 582
EcoT14I CCWWGG 1 cut(s) 509
EcoT38I GRGCYC 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 509
FaeI CATG 2 cut(s) 698, 913
FalI AAGNNNNNCTT 2 cut(s) 324, 356
FaqI GGGAC 2 cut(s) 585, 730
FatI CATG 2 cut(s) 694, 909
Fnu4HI GCNGC 4 cut(s) 543, 732, 954, 985
FokI GGATG 1 cut(s) 638
FriOI GRGCYC 1 cut(s) 177
Fsp4HI GCNGC 4 cut(s) 543, 732, 954, 985
FspBI CTAG 3 cut(s) 17, 395, 666
GluI GCNGC 4 cut(s) 543, 732, 954, 985
GsaI CCCAGC 1 cut(s) 539
HaeIII GGCC 4 cut(s) 676, 756, 844, 1012
HapII CCGG 2 cut(s) 841, 1009
Hin1II CATG 2 cut(s) 698, 913
HindIII AAGCTT 4 cut(s) 87, 212, 389, 860
HinfI GANTC 5 cut(s) 57, 182, 307, 1021, 1058
HpaII CCGG 2 cut(s) 841, 1009
HphI GGTGA 4 cut(s) 230, 365, 598, 695
Hpy188I TCNGA 2 cut(s) 652, 960
Hpy188III TCNNGA 6 cut(s) 50, 232, 517, 596, 928, 1039
HpyAV CCTTC 5 cut(s) 90, 133, 148, 215, 665
HpyCH4III ACNGT 3 cut(s) 689, 882, 896
HpyCH4V TGCA 6 cut(s) 83, 208, 344, 890, 953, 1001
HpyF10VI GCNNNNNNNGC 1 cut(s) 974
HpyF3I CTNAG 5 cut(s) 176, 469, 649, 829, 929
Hsp92II CATG 2 cut(s) 698, 913
Kzo9I GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
LmnI GCTCC 3 cut(s) 142, 465, 853
Lsp1109I GCAGC 4 cut(s) 529, 718, 965, 971
LweI GCATC 1 cut(s) 1109
MaeI CTAG 3 cut(s) 17, 395, 666
MaeIII GTNAC 3 cut(s) 522, 683, 773
MalI GATC 8 cut(s) 5, 25, 428, 477, 515, 809, 921, 1037
MboI GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
MboII GAAGA 3 cut(s) 33, 497, 1067
MflI RGATCY 4 cut(s) 426, 807, 919, 1035
MhlI GDGCHC 2 cut(s) 177, 621
MluCI AATT 7 cut(s) 125, 148, 282, 353, 963, 1090, 1112
MmeI TCCRAC 1 cut(s) 454
MroXI GAANNNNTTC 1 cut(s) 158
MseI TTAA 1 cut(s) 636
MspA1I CMGCKG 1 cut(s) 851
MspI CCGG 2 cut(s) 841, 1009
MspR9I CCNGG 1 cut(s) 584
Mva1269I GAATGC 1 cut(s) 1003
MvaI CCWGG 1 cut(s) 584
MwoI GCNNNNNNNGC 1 cut(s) 974
NdeII GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
NlaIII CATG 2 cut(s) 698, 913
NlaIV GGNNCC 2 cut(s) 48, 428
NmuCI GTSAC 2 cut(s) 683, 773
PctI GAATGC 1 cut(s) 1003
PdmI GAANNNNTTC 1 cut(s) 158
PfeI GAWTC 5 cut(s) 57, 182, 307, 1021, 1058
PkrI GCNGC 4 cut(s) 544, 733, 955, 986
Psp124BI GAGCTC 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 582
PspEI GGTNACC 1 cut(s) 683
PspFI CCCAGC 1 cut(s) 535
PspGI CCWGG 1 cut(s) 582
PspN4I GGNNCC 2 cut(s) 48, 428
PspPI GGNCC 1 cut(s) 674
PstI CTGCAG 2 cut(s) 892, 955
PsuI RGATCY 4 cut(s) 426, 807, 919, 1035
RsaI GTAC 5 cut(s) 131, 277, 691, 884, 1072
RsaNI GTAC 5 cut(s) 130, 276, 690, 883, 1071
SacI GAGCTC 1 cut(s) 177
SaqAI TTAA 1 cut(s) 636
SatI GCNGC 4 cut(s) 543, 732, 954, 985
Sau3AI GATC 8 cut(s) 3, 23, 426, 475, 513, 807, 919, 1035
Sau96I GGNCC 1 cut(s) 674
ScrFI CCNGG 1 cut(s) 584
SduI GDGCHC 2 cut(s) 177, 621
SfaNI GCATC 1 cut(s) 1109
SfcI CTRYAG 4 cut(s) 408, 888, 951, 1050
SmlI CTYRAG 1 cut(s) 546
SmoI CTYRAG 1 cut(s) 546
Sse9I AATT 7 cut(s) 125, 148, 282, 353, 963, 1090, 1112
SsiI CCGC 1 cut(s) 851
SspI AATATT 1 cut(s) 941
SspMI CTAG 3 cut(s) 17, 395, 666
SstI GAGCTC 1 cut(s) 177
StyD4I CCNGG 1 cut(s) 582
StyI CCWWGG 1 cut(s) 509
TaaI ACNGT 3 cut(s) 689, 882, 896
TaqI TCGA 2 cut(s) 595, 701
TasI AATT 7 cut(s) 125, 148, 282, 353, 963, 1090, 1112
TatI WGTACW 1 cut(s) 129
TfiI GAWTC 5 cut(s) 57, 182, 307, 1021, 1058
Tru1I TTAA 1 cut(s) 636
Tru9I TTAA 1 cut(s) 636
TscAI CASTG 2 cut(s) 714, 820
TseFI GTSAC 2 cut(s) 683, 773
TseI GCWGC 4 cut(s) 542, 731, 953, 984
Tsp45I GTSAC 2 cut(s) 683, 773
TspDTI ATGAA 2 cut(s) 462, 1034
TspGWI ACGGA 1 cut(s) 754
TspRI CASTG 2 cut(s) 714, 820
XapI RAATTY 1 cut(s) 148
XcmI CCANNNNNNNNNTGG 1 cut(s) 619
XmnI GAANNNNTTC 1 cut(s) 158
XspI CTAG 3 cut(s) 17, 395, 666
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.