Rmu_ssc0000389.1_g000019

ABC transporter B family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000389.1
Physical Location & Seq
Reverse (-)
112679 .. 118003
5325 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000389.1_g000019.1.cds

Sequence Viewer

Length: 3759 bp
atggaagacaaaatggagagcaagaagaaagctggctcttctatacgctccgttttcatgcacgctgatggtgttgataaactcttgatggcgttggggctgttcggaagcatcggagacggctgcacaacgcctctggtcttgttgatcactagccgcttgatgaacaatgtcggcggcgcctcatccaacgctcaagatgctttcttgcatagcatcaataagaatgcagtggcgctattgtacttggcttctgcatcatttgtttgttgcttcctagagggatattcttggacaagaactggtgagagacaagcagctagaatgagagtaagatatttgaaagcagtgttaagacaagatgtgggctactttgatttgcatgtcacaagcacctcagaggttatcaccagcgtctctagtgatagccttgtcattcaagacgtccttagtgaaaaggtgccaaactttgtaatgaactgctctatgttccttgggagctatgttgcggcgttcataatgctgtggaggctagccatcgttgggtttccgtttgtggtgcttctggtgattccgggtttgatatacggacggactttgatgggactggctaggcagattagagatgaatacaccaaggctggcacaatagcagaacaggcactgtcatcaattagaaccgtgtatgcatttgttggagaaaagaagactataacagagttctctgcagctctacaaggctcagtgaagttggggttgagtcagggcctggcaaaaggcttggccattggaagcaacggtgtcgttttcgcgatttggtcgttcatgtcctactatggcagcagaatggtcatgtaccatggcgctaagggaggcactgttttcgctgttggtgctgcaatagctgttggtggattggcattgggcgcaggcttatcaaacttgaagtacttctcagaagcgtgttcagccgctgaacgaataatggaggtgattcggagagtccccaagatcgattcagacaacatggaaggagaaatactagagaacgttttaggggaagttgaattcaagcacgtagaattcgcctacccgtcaaggccagaaagcattatcttcaaagacttcaacttaacggttccagctgggaaaacagtggcattggtgggtggtagtggctccggaaaatcgacagtgatttcgctgttgcagagattttatgatccactcgggggagagattctcattgatggggtggccataaacaagtgtcagctcaagtggttgaggtcacagatgggactggtgagccaagagcctgctctgtttgcaaccagcataaaagagaacatactttttgggaaagaagatgctaccattgaagaggttattgaggctggtaaagcttctaatgctgacaatttcatctctcagttgcctctgggatatgacacacaggttggcgagagaggtgttcaaatgtcgggagggcagaagcaaagaatagccattgcccgagcaatcatcaagaaaccacgcatccttcttctagatgaagccacgagcgcattggactccgaatcggagcgtgtagttcaagaagctcttgataaagcagctgtcggacgtacgacgataatcatcgcccaccgcctctctaccatccgaaacgccgacgtcattactgtcgttcaaaacgggcaggtcatggagacgggctcacacaacgagctattccaacgtgaaaatggtctctatacctcgcttgtccgcttacaacaaacagagaagcaaagaggaccagaagagcaaggacattacgcatcgtcatctatatcaaacatggacattcacaacacaagcagtcgtaggctttctatggtcagccgctccagttctgctaactcatttgcgcaaggtcgagcttcatcagtggttgctggggaagatgagatcgtagaagggcagaagctgcctgtcccatcttttcggagattgatagctttgaaccttccggagtggaaacaagcgcttttggggtgcttcagtgctgttctttttggtgcagttcagccagcatatgcatttgctatggggtcaatggtgtcggtttatttcttgacagatcacgatgagatcaaggagaagacgaggatttattcactttgctttctggggttggctattttctctttgctggttaacatttgccagcattacaactttgcctacatgggagagtacttgactaagagagttagagagaggatgctttccaagattcttacattcgaagttgggtggtttgatcaagatgagaattccagtggtgccatttgctctagactcgccaaagatgccaatgtggtgagatctttagtgggtgatcggatggctctacttgttcaaactttctcagctgtgactgtagcctgcacaatgggtttggtcattgcatggagacttgcctcagttatgatagcagtacaacccattatcattgtgagctactacaccaggcgtgtcctgctcaaaagtatgtccaggaaagccatcaaagctcaagatgaaagcagcaagctagctgcagaagcagtctccaacctcagaaccatcactgccttctcatctcaggaccgtctgttgaaaatgctcgaaaaggcccaagaaggcccacgtaaggaaagcatccgacaatcgtggtttgcggggattggacttggttgttctcaaagccttacgactatcacctgggcttttgacttttggtacggtggcaagctcgttgccaagggctacgtcacagcaaaagctctttttgagactttcatgatattggtgagcacgggccgggttattgccgatgccggaagcatgacttcagatcttgcgaaagggtcggatgctgttgcgtccgtatttgcagtgttggaccggtacacaaaaatagaacccgaagacccggaaggttgcgagcccaaaagaataaccggtcacatagaatttcgtaacgtacattttgcataccccgctaggcctgatgtgatgattttcaaaggattctcaatcaaaatcgaagctggaaaatcaactgcattggtgggacaaagcgggtctggaaagtcaacaatcattggattaatcgaaagattttatgatccattaaaaggagaagtgataattgacggtcgagacacgaaatcgtaccacctcaggtcattaaggaaacatatagcacttgttagccaagagccaacgttatttttaggtaccataagagagaacatcatgtatggcatgtcggataagattgacgaattggagataatcgaagcagcgaaggcagccaacgctcatgatttcatttcaagcctcaaggagggatatgacacttcatgtggagacagaggagtgcaactatctgggggacagaagcaacgcattgctatagcgagagctatattgagaaacccagtggtgttactattagatgaggcgaccagtgcgcttgatagtcagtcggaaaaggtggtgcaagatgcgctagagcgggtgatggtggggaggactagtgtggtggtggcgcacaggttgagtaccatacaacactgtgatcttatcacagtacttgataaagggagggtagtggagaaagggactcactcatctcttttggccaaagggcctaaaggttcttactactcattggttagcttgcaaaggacgccatctgcatcagatcttactaaattgccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

1252

Amino Acids

136.56

Weight (kDa)

8.81

Isoelectric Point (pI)

40.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000317)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G28345 AT3G28360 AT3G28380 AT3G28390 AT3G28415 AT3G28415
fragaria_vesca FvH4_1g06060 FvH4_3g21880 FvH4_4g25260 FvH4_6g49750 FvH4_6g49750 FvH4_6g49750 FvH4_6g49750 FvH4_6g49760
malus_domestica MD00G1221200.v1.1 MD02G1065200.v1.1 MD03G1211200.v1.1 MD09G1041500.v1.1 MD09G1041600.v1.1 MD09G1041900.v1.1 MD15G1196000.v1.1 MD16G1105600.v1.1 MD17G1042800.v1.1
prunus_persica Prupe.1G241000_v2.0.a1 Prupe.3G275900_v2.0.a1 Prupe.3G276100_v2.0.a1 Prupe.3G276100_v2.0.a1 Prupe.4G204300_v2.0.a1 Prupe.7G220300_v2.0.a1
pyrus_communis pycom111g03260 pycom16g08980 pycom17g03840
rosa_chinensis RchiOBHm_Chr2g0091821 RchiOBHm_Chr2g0169781 RchiOBHm_Chr2g0169791 RchiOBHm_Chr2g0169801 RchiOBHm_Chr2g0169841 RchiOBHm_Chr2g0169851 RchiOBHm_Chr2g0169861 RchiOBHm_Chr4g0432501 RchiOBHm_Chr5g0037681 RchiOBHm_Chr5g0037691
rosa_laevigata RLG00000006836 RLG00000016254 RLG00000021903 RLG00000021904 RLG00000021905 RLG00000021906 RLG00000021907 RLG00000021908 RLG00000033801
rosa_multiflora Rmu_sc0001084.1_g000003 Rmu_sc0021402.1_g000003 Rmu_ssc0000389.1_g000016 Rmu_ssc0000389.1_g000019 Rmu_ssc0000389.1_g000024 Rmu_ssc0000389.1_g000027
rosa_roxburghii Rroxscaffold_1G00043250 Rroxscaffold_2G00081770 Rroxscaffold_2G00081780 Rroxscaffold_2G00081790 Rroxscaffold_2G00149710 Rroxscaffold_5G00373960
rosa_rugosa Rorug02G0021300 Rorug02G0543400.1 Rorug02G0543500.1 Rorug02G0543600.1 Rorug02G0543700.1 Rorug02G0543800 Rorug02G0543900 Rorug02G0544000 Rorug04G0259900.1 Rorug05G0166300 Rorug05G0166300
rosa_samantha Rh2AG065900 Rh2AG615300 Rh2AG615400 Rh2AG615500 Rh2AG615600 Rh2AG615700 Rh2AG615800 Rh2AG616000 Rh2AG616200 Rh2BG627600 Rh2BG627700 Rh2BG627800 Rh2BG627900 Rh2BG628000 Rh2BG628100 Rh2CG596900 Rh2CG597000 Rh2CG597100 Rh2CG597200 Rh2DG065000 Rh2DG638400 Rh2DG638600 Rh2DG638700 Rh2DG638800 Rh2DG638900 Rh2DG639000 Rh4AG314700 Rh4BG322400 Rh4CG337600 Rh4DG318300 Rh5AG255800 Rh5BG257900 Rh5CG291300
rosa_wichuraiana Rw0G002540 Rw2G005480 Rw2G051010 Rw2G051020 Rw2G051030 Rw2G051040 Rw4G027360 Rw5G023710 Rw5G024000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 447, 1680
Acc16I TGCGCA 1 cut(s) 1914
Acc36I ACCTGC 1 cut(s) 1693
Acc65I GGTACC 1 cut(s) 3269
AccB1I GGYRCC 4 cut(s) 179, 460, 2330, 3269
AccBSI CCGCTC 2 cut(s) 1890, 3550
AccII CGCG 1 cut(s) 812
AccIII TCCGGA 2 cut(s) 1181, 2014
AclI AACGTT 2 cut(s) 1050, 3257
AclWI GGATC 2 cut(s) 1217, 3152
AcoI YGGCCR 3 cut(s) 783, 1257, 3675
AcsI RAATTY 4 cut(s) 1067, 1082, 2320, 3002
AcuI CTGAAG 2 cut(s) 2029, 2865
AcyI GRCGYC 4 cut(s) 180, 444, 1677, 3725
AfeI AGCGCT 1 cut(s) 2031
AfiI CCNNNNNNNGG 5 cut(s) 543, 1232, 2680, 3167, 3379
AgeI ACCGGT 2 cut(s) 2934, 2990
AhlI ACTAGT 1 cut(s) 3569
AjnI CCWGG 4 cut(s) 768, 2516, 2543, 2750
Alw21I GWGCWC 1 cut(s) 2846
AlwI GGATC 2 cut(s) 1217, 3152
AlwNI CAGNNNCTG 4 cut(s) 664, 769, 974, 1972
Ama87I CYCGRG 2 cut(s) 1229, 1515
Aor13HI TCCGGA 2 cut(s) 1181, 2014
Aor51HI AGCGCT 1 cut(s) 2031
ApoI RAATTY 4 cut(s) 1067, 1082, 2320, 3002
ArsI GACNNNNNNTTYG 2 cut(s) 1183, 1215
AseI ATTAAT 1 cut(s) 3140
AsiGI ACCGGT 2 cut(s) 2934, 2990
Asp700I GAANNNNTTC 1 cut(s) 950
Asp718I GGTACC 1 cut(s) 3269
AspS9I GGNCC 8 cut(s) 766, 1799, 2635, 2662, 2672, 2848, 2932, 3683
AsuC2I CCSGG 3 cut(s) 576, 2852, 2963
AsuII TTCGAA 1 cut(s) 2292
AsuNHI GCTAGC 2 cut(s) 532, 2581
AvaI CYCGRG 2 cut(s) 1229, 1515
AvaII GGWCC 3 cut(s) 1799, 2635, 2932
AxyI CCTNAGG 1 cut(s) 3212
BalI TGGCCA 3 cut(s) 785, 1259, 3677
BanI GGYRCC 4 cut(s) 179, 460, 2330, 3269
BanII GRGCYC 2 cut(s) 1721, 2979
BarI GAAGNNNNNNTAC 2 cut(s) 1023, 1055
BauI CACGAG 1 cut(s) 1561
BbsI GAAGAC 4 cut(s) 12, 713, 2153, 2964
Bbv12I GWGCWC 1 cut(s) 2846
BceAI ACGGC 1 cut(s) 136
BcgI CGANNNNNNTGC 4 cut(s) 784, 818, 865, 899
BciT130I CCWGG 4 cut(s) 770, 2518, 2545, 2752
BclI TGATCA 2 cut(s) 147, 2308
BcnI CCSGG 3 cut(s) 576, 2852, 2963
BcuI ACTAGT 1 cut(s) 3569
BfmI CTRYAG 4 cut(s) 726, 2427, 2586, 3447
BfoI RGCGCY 4 cut(s) 183, 239, 867, 2033
BfuAI ACCTGC 1 cut(s) 1693
BglII AGATCT 3 cut(s) 2372, 2884, 3739
BmcAI AGTACT 3 cut(s) 950, 2243, 3627
Bme1390I CCNGG 7 cut(s) 576, 770, 2518, 2545, 2752, 2852, 2963
Bme18I GGWCC 3 cut(s) 1799, 2635, 2932
BmeT110I CYCGRG 2 cut(s) 1229, 1515
BmgT120I GGNCC 8 cut(s) 766, 1799, 2635, 2662, 2672, 2848, 2932, 3683
BmiI GGNNCC 6 cut(s) 181, 462, 1140, 1180, 2332, 3271
BmrFI CCNGG 7 cut(s) 576, 770, 2518, 2545, 2752, 2852, 2963
BmrI ACTGGG 1 cut(s) 3467
BmtI GCTAGC 2 cut(s) 536, 2585
BmuI ACTGGG 1 cut(s) 3467
BpiI GAAGAC 4 cut(s) 12, 713, 2153, 2964
BplI GAGNNNNNCTC 4 cut(s) 1227, 1259, 1703, 1735
BpmI CTGGAG 1 cut(s) 1876
Bpu10I CCTNAGC 1 cut(s) 867
Bpu14I TTCGAA 1 cut(s) 2292
BpuEI CTTGAG 4 cut(s) 180, 1262, 2547, 3359
BpuMI CCSGG 3 cut(s) 576, 2852, 2963
Bsa29I ATCGAT 1 cut(s) 1014
BsaAI YACGTR 2 cut(s) 1078, 2678
BsaBI GATNNNNATC 1 cut(s) 1640
BsaHI GRCGYC 4 cut(s) 180, 444, 1677, 3725
BsaI GGTCTC 1 cut(s) 1757
BsaJI CCNNGG 5 cut(s) 493, 636, 859, 2751, 2790
BsaWI WCCGGW 4 cut(s) 1181, 2014, 2934, 2990
BsaXI ACNNNNNCTCC 4 cut(s) 864, 894, 3556, 3586
Bsc4I CCNNNNNNNGG 5 cut(s) 543, 1232, 2680, 3167, 3379
Bse118I RCCGGY 2 cut(s) 2934, 2990
Bse1I ACTGG 7 cut(s) 307, 612, 1308, 1893, 2325, 3473, 3501
Bse21I CCTNAGG 1 cut(s) 3212
Bse3DI GCAATG 3 cut(s) 1509, 2451, 3441
Bse8I GATNNNNATC 1 cut(s) 1640
BseAI TCCGGA 2 cut(s) 1181, 2014
BseBI CCWGG 4 cut(s) 770, 2518, 2545, 2752
BseCI ATCGAT 1 cut(s) 1014
BseDI CCNNGG 5 cut(s) 493, 636, 859, 2751, 2790
BseGI GGATG 7 cut(s) 185, 1539, 1662, 2274, 2397, 2688, 2908
BseJI GATNNNNATC 1 cut(s) 1640
BseLI CCNNNNNNNGG 5 cut(s) 543, 1232, 2680, 3167, 3379
BseMI GCAATG 3 cut(s) 1509, 2451, 3441
BseMII CTCAG 9 cut(s) 411, 756, 969, 1445, 2430, 2484, 2620, 2645, 3226
BseNI ACTGG 7 cut(s) 307, 612, 1308, 1893, 2325, 3473, 3501
BseRI GAGGAG 1 cut(s) 3423
BseYI CCCAGC 2 cut(s) 1145, 1940
BsgI GTGCAG 3 cut(s) 109, 2085, 2419
Bsh1236I CGCG 1 cut(s) 812
Bsh1285I CGRYCG 1 cut(s) 3190
BshNI GGYRCC 4 cut(s) 179, 460, 2330, 3269
BshTI ACCGGT 2 cut(s) 2934, 2990
BshVI ATCGAT 1 cut(s) 1014
BsiEI CGRYCG 1 cut(s) 3190
BsiHKAI GWGCWC 1 cut(s) 2846
BsiHKCI CYCGRG 2 cut(s) 1229, 1515
BsiSI CCGG 8 cut(s) 575, 1182, 2015, 2851, 2868, 2935, 2963, 2991
BsiWI CGTACG 1 cut(s) 1628
BslFI GGGAC 7 cut(s) 618, 989, 1314, 1964, 3117, 3441, 3670
BslI CCNNNNNNNGG 5 cut(s) 543, 1232, 2680, 3167, 3379
BsmBI CGTCTC 3 cut(s) 111, 421, 1706
BsmFI GGGAC 7 cut(s) 618, 989, 1314, 1964, 3117, 3441, 3670
BsmI GAATGC 1 cut(s) 232
Bso31I GGTCTC 1 cut(s) 1757
BsoBI CYCGRG 2 cut(s) 1229, 1515
Bsp119I TTCGAA 1 cut(s) 2292
Bsp1286I GDGCHC 3 cut(s) 1721, 2846, 2979
Bsp13I TCCGGA 2 cut(s) 1181, 2014
Bsp19I CCATGG 1 cut(s) 859
Bsp68I TCGCGA 1 cut(s) 812
BspCNI CTCAG 9 cut(s) 410, 755, 968, 1444, 2429, 2483, 2619, 2644, 3225
BspDI ATCGAT 1 cut(s) 1014
BspEI TCCGGA 2 cut(s) 1181, 2014
BspFNI CGCG 1 cut(s) 812
BspHI TCATGA 2 cut(s) 2829, 3355
BspLI GGNNCC 6 cut(s) 181, 462, 1140, 1180, 2332, 3271
BspMAI CTGCAG 2 cut(s) 730, 2590
BspMI ACCTGC 1 cut(s) 1693
BspOI GCTAGC 2 cut(s) 536, 2585
BspPI GGATC 2 cut(s) 1217, 3152
BspQI GCTCTTC 2 cut(s) 43, 1800
BspT104I TTCGAA 1 cut(s) 2292
BspT107I GGYRCC 4 cut(s) 179, 460, 2330, 3269
BspTNI GGTCTC 1 cut(s) 1757
BsrBI CCGCTC 2 cut(s) 1890, 3550
BsrDI GCAATG 3 cut(s) 1509, 2451, 3441
BsrFI RCCGGY 2 cut(s) 2934, 2990
BsrI ACTGG 7 cut(s) 307, 612, 1308, 1893, 2325, 3473, 3501
BssAI RCCGGY 2 cut(s) 2934, 2990
BssECI CCNNGG 5 cut(s) 493, 636, 859, 2751, 2790
BssNI GRCGYC 4 cut(s) 180, 444, 1677, 3725
BssSI CACGAG 1 cut(s) 1561
BssT1I CCWWGG 4 cut(s) 493, 636, 859, 2790
Bst2BI CACGAG 1 cut(s) 1561
Bst2UI CCWGG 4 cut(s) 770, 2518, 2545, 2752
Bst6I CTCTTC 3 cut(s) 43, 1377, 1800
BstACI GRCGYC 4 cut(s) 180, 444, 1677, 3725
BstAPI GCANNNNNTGC 1 cut(s) 1972
BstBAI YACGTR 2 cut(s) 1078, 2678
BstBI TTCGAA 1 cut(s) 2292
BstDSI CCRYGG 1 cut(s) 859
BstENI CCTNNNNNAGG 1 cut(s) 3377
BstF5I GGATG 7 cut(s) 185, 1539, 1662, 2274, 2397, 2688, 2908
BstFNI CGCG 1 cut(s) 812
BstH2I RGCGCY 4 cut(s) 183, 239, 867, 2033
BstMCI CGRYCG 1 cut(s) 3190
BstNI CCWGG 4 cut(s) 770, 2518, 2545, 2752
BstNSI RCATGY 2 cut(s) 386, 3301
BstSCI CCNGG 7 cut(s) 574, 768, 2516, 2543, 2750, 2850, 2961
BstSFI CTRYAG 4 cut(s) 726, 2427, 2586, 3447
BstUI CGCG 1 cut(s) 812
BstV2I GAAGAC 4 cut(s) 12, 713, 2153, 2964
BstX2I RGATCY 3 cut(s) 2372, 2884, 3739
BstYI RGATCY 3 cut(s) 2372, 2884, 3739
Bsu15I ATCGAT 1 cut(s) 1014
Bsu36I CCTNAGG 1 cut(s) 3212
BsuTUI ATCGAT 1 cut(s) 1014
BtgI CCRYGG 1 cut(s) 859
BtgZI GCGATG 1 cut(s) 1627
BtsCI GGATG 7 cut(s) 185, 1539, 1662, 2274, 2397, 2688, 2908
BtsI GCAGTG 4 cut(s) 237, 354, 2616, 2931
BtuMI TCGCGA 1 cut(s) 812
BveI ACCTGC 1 cut(s) 1693
CaiI CAGNNNCTG 4 cut(s) 664, 769, 974, 1972
CciI TCATGA 2 cut(s) 2829, 3355
Cfr10I RCCGGY 2 cut(s) 2934, 2990
Cfr13I GGNCC 8 cut(s) 766, 1799, 2635, 2662, 2672, 2848, 2932, 3683
ClaI ATCGAT 1 cut(s) 1014
CseI GACGC 3 cut(s) 403, 2901, 3733
CspAI ACCGGT 2 cut(s) 2934, 2990
DinI GGCGCC 1 cut(s) 181
EaeI YGGCCR 3 cut(s) 783, 1257, 3675
Eam1104I CTCTTC 3 cut(s) 43, 1377, 1800
EarI CTCTTC 3 cut(s) 43, 1377, 1800
Eco130I CCWWGG 4 cut(s) 493, 636, 859, 2790
Eco147I AGGCCT 1 cut(s) 3037
Eco24I GRGCYC 2 cut(s) 1721, 2979
Eco31I GGTCTC 1 cut(s) 1757
Eco47I GGWCC 3 cut(s) 1799, 2635, 2932
Eco47III AGCGCT 1 cut(s) 2031
Eco57I CTGAAG 2 cut(s) 2029, 2865
Eco81I CCTNAGG 1 cut(s) 3212
Eco88I CYCGRG 2 cut(s) 1229, 1515
EcoNI CCTNNNNNAGG 1 cut(s) 3377
EcoO109I RGGNCCY 2 cut(s) 766, 3683
EcoRI GAATTC 3 cut(s) 1067, 1082, 2320
EcoRII CCWGG 4 cut(s) 768, 2516, 2543, 2750
EcoT14I CCWWGG 4 cut(s) 493, 636, 859, 2790
EcoT22I ATGCAT 2 cut(s) 691, 2086
EcoT38I GRGCYC 2 cut(s) 1721, 2979
EgeI GGCGCC 1 cut(s) 181
EheI GGCGCC 1 cut(s) 181
ErhI CCWWGG 4 cut(s) 493, 636, 859, 2790
Esp3I CGTCTC 3 cut(s) 111, 421, 1706
FalI AAGNNNNNCTT 6 cut(s) 432, 464, 1590, 1622, 2863, 2895
FaqI GGGAC 7 cut(s) 618, 989, 1314, 1964, 3117, 3441, 3670
FauI CCCGC 4 cut(s) 2701, 3037, 3104, 3543
FauNDI CATATG 1 cut(s) 2080
FbaI TGATCA 2 cut(s) 147, 2308
FokI GGATG 7 cut(s) 172, 1526, 1649, 2281, 2404, 2675, 2915
FriOI GRGCYC 2 cut(s) 1721, 2979
FspI TGCGCA 1 cut(s) 1914
GsaI CCCAGC 2 cut(s) 1149, 1944
GsuI CTGGAG 1 cut(s) 1876
HaeII RGCGCY 4 cut(s) 183, 239, 867, 2033
HapII CCGG 8 cut(s) 575, 1182, 2015, 2851, 2868, 2935, 2963, 2991
HgaI GACGC 3 cut(s) 403, 2901, 3733
Hin1I GRCGYC 4 cut(s) 180, 444, 1677, 3725
HincII GTYRAC 2 cut(s) 2203, 3126
HindII GTYRAC 2 cut(s) 2203, 3126
HindIII AAGCTT 1 cut(s) 1404
HpaI GTTAAC 1 cut(s) 2203
HpaII CCGG 8 cut(s) 575, 1182, 2015, 2851, 2868, 2935, 2963, 2991
Hpy166II GTNNAC 3 cut(s) 2203, 2940, 3126
Hpy8I GTNNAC 3 cut(s) 2203, 2940, 3126
Hpy99I CGWCG 2 cut(s) 1636, 1679
HpyAV CCTTC 8 cut(s) 1025, 1553, 1955, 2021, 2632, 2663, 2960, 3334
Hsp92I GRCGYC 4 cut(s) 180, 444, 1677, 3725
KasI GGCGCC 1 cut(s) 179
Kpn2I TCCGGA 2 cut(s) 1181, 2014
KpnI GGTACC 1 cut(s) 3273
Ksp22I TGATCA 2 cut(s) 147, 2308
KspAI GTTAAC 1 cut(s) 2203
LguI GCTCTTC 2 cut(s) 43, 1800
LmnI GCTCC 5 cut(s) 53, 498, 1184, 1585, 1895
MaeIII GTNAC 7 cut(s) 385, 1290, 2422, 2800, 2993, 3008, 3480
MbiI CCGCTC 2 cut(s) 1890, 3550
MflI RGATCY 3 cut(s) 2372, 2884, 3739
MhlI GDGCHC 3 cut(s) 1721, 2846, 2979
MlsI TGGCCA 3 cut(s) 785, 1259, 3677
MluCI AATT 9 cut(s) 672, 1067, 1082, 1420, 2320, 3002, 3180, 3317, 3749
MluNI TGGCCA 3 cut(s) 785, 1259, 3677
Mly113I GGCGCC 1 cut(s) 180
MlyI GAGTC 5 cut(s) 769, 1011, 1568, 2340, 3652
Mox20I TGGCCA 3 cut(s) 785, 1259, 3677
Mph1103I ATGCAT 2 cut(s) 691, 2086
MroI TCCGGA 2 cut(s) 1181, 2014
MroXI GAANNNNTTC 1 cut(s) 950
MscI TGGCCA 3 cut(s) 785, 1259, 3677
MseI TTAA 6 cut(s) 353, 1133, 2202, 3140, 3164, 3221
MslI CAYNNNNRTG 1 cut(s) 66
Msp20I TGGCCA 3 cut(s) 785, 1259, 3677
MspA1I CMGCKG 4 cut(s) 974, 1145, 1619, 2420
MspI CCGG 8 cut(s) 575, 1182, 2015, 2851, 2868, 2935, 2963, 2991
MspR9I CCNGG 7 cut(s) 576, 770, 2518, 2545, 2752, 2852, 2963
Mva1269I GAATGC 1 cut(s) 232
MvaI CCWGG 4 cut(s) 770, 2518, 2545, 2752
MvnI CGCG 1 cut(s) 812
NarI GGCGCC 1 cut(s) 180
NciI CCSGG 3 cut(s) 576, 2852, 2963
NcoI CCATGG 1 cut(s) 859
NdeI CATATG 1 cut(s) 2080
NheI GCTAGC 2 cut(s) 532, 2581
NlaIV GGNNCC 6 cut(s) 181, 462, 1140, 1180, 2332, 3271
NmuCI GTSAC 5 cut(s) 385, 1290, 2422, 2800, 2993
NruI TCGCGA 1 cut(s) 812
NsbI TGCGCA 1 cut(s) 1914
NsiI ATGCAT 2 cut(s) 691, 2086
NspI RCATGY 2 cut(s) 386, 3301
NspV TTCGAA 1 cut(s) 2292
PagI TCATGA 2 cut(s) 2829, 3355
PceI AGGCCT 1 cut(s) 3037
PciSI GCTCTTC 2 cut(s) 43, 1800
PctI GAATGC 1 cut(s) 232
PdmI GAANNNNTTC 1 cut(s) 950
PfeI GAWTC 7 cut(s) 571, 994, 1016, 1240, 1580, 2281, 3060
Pfl23II CGTACG 1 cut(s) 1628
PfoI TCCNGGA 1 cut(s) 2543
PinAI ACCGGT 2 cut(s) 2934, 2990
PleI GAGTC 5 cut(s) 768, 1010, 1568, 2340, 3652
PluTI GGCGCC 1 cut(s) 183
PpsI GAGTC 5 cut(s) 768, 1010, 1568, 2340, 3652
Ppu21I YACGTR 2 cut(s) 1078, 2678
PshBI ATTAAT 1 cut(s) 3140
Psp1406I AACGTT 2 cut(s) 1050, 3257
Psp6I CCWGG 4 cut(s) 768, 2516, 2543, 2750
PspFI CCCAGC 2 cut(s) 1145, 1940
PspGI CCWGG 4 cut(s) 768, 2516, 2543, 2750
PspLI CGTACG 1 cut(s) 1628
PspN4I GGNNCC 6 cut(s) 181, 462, 1140, 1180, 2332, 3271
PspPI GGNCC 8 cut(s) 766, 1799, 2635, 2662, 2672, 2848, 2932, 3683
PstI CTGCAG 2 cut(s) 730, 2590
PstNI CAGNNNCTG 4 cut(s) 664, 769, 974, 1972
PsuI RGATCY 3 cut(s) 2372, 2884, 3739
PvuII CAGCTG 3 cut(s) 1145, 1619, 2420
RruI TCGCGA 1 cut(s) 812
RseI CAYNNNNRTG 1 cut(s) 66
SapI GCTCTTC 2 cut(s) 43, 1800
SaqAI TTAA 6 cut(s) 353, 1133, 2202, 3140, 3164, 3221
Sau96I GGNCC 8 cut(s) 766, 1799, 2635, 2662, 2672, 2848, 2932, 3683
ScaI AGTACT 3 cut(s) 950, 2243, 3627
SchI GAGTC 5 cut(s) 769, 1011, 1568, 2340, 3652
ScrFI CCNGG 7 cut(s) 576, 770, 2518, 2545, 2752, 2852, 2963
SduI GDGCHC 3 cut(s) 1721, 2846, 2979
SfcI CTRYAG 4 cut(s) 726, 2427, 2586, 3447
SfoI GGCGCC 1 cut(s) 181
SfuI TTCGAA 1 cut(s) 2292
SinI GGWCC 3 cut(s) 1799, 2635, 2932
SmiMI CAYNNNNRTG 1 cut(s) 66
SmlI CTYRAG 4 cut(s) 195, 1277, 2562, 3374
SmoI CTYRAG 4 cut(s) 195, 1277, 2562, 3374
SpeI ACTAGT 1 cut(s) 3569
Sse9I AATT 9 cut(s) 672, 1067, 1082, 1420, 2320, 3002, 3180, 3317, 3749
SseBI AGGCCT 1 cut(s) 3037
SspDI GGCGCC 1 cut(s) 179
StuI AGGCCT 1 cut(s) 3037
StyD4I CCNGG 7 cut(s) 574, 768, 2516, 2543, 2750, 2850, 2961
StyI CCWWGG 4 cut(s) 493, 636, 859, 2790
TaqI TCGA 9 cut(s) 1014, 1190, 1921, 2292, 2655, 3075, 3144, 3190, 3330
TasI AATT 9 cut(s) 672, 1067, 1082, 1420, 2320, 3002, 3180, 3317, 3749
TatI WGTACW 5 cut(s) 243, 948, 2241, 2485, 3625
TauI GCSGC 5 cut(s) 159, 180, 512, 974, 1890
TfiI GAWTC 7 cut(s) 571, 994, 1016, 1240, 1580, 2281, 3060
Tru1I TTAA 6 cut(s) 353, 1133, 2202, 3140, 3164, 3221
Tru9I TTAA 6 cut(s) 353, 1133, 2202, 3140, 3164, 3221
TseFI GTSAC 5 cut(s) 385, 1290, 2422, 2800, 2993
Tsp45I GTSAC 5 cut(s) 385, 1290, 2422, 2800, 2993
TspGWI ACGGA 5 cut(s) 40, 540, 603, 607, 2905
VpaK11BI GGWCC 3 cut(s) 1799, 2635, 2932
VspI ATTAAT 1 cut(s) 3140
XagI CCTNNNNNAGG 1 cut(s) 3377
XapI RAATTY 4 cut(s) 1067, 1082, 2320, 3002
XbaI TCTAGA 2 cut(s) 1549, 2342
XceI RCATGY 2 cut(s) 386, 3301
XcmI CCANNNNNNNNNTGG 2 cut(s) 1567, 1745
XmnI GAANNNNTTC 1 cut(s) 950
ZraI GACGTC 2 cut(s) 445, 1678
ZrmI AGTACT 3 cut(s) 950, 2243, 3627
Zsp2I ATGCAT 2 cut(s) 691, 2086
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.