Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000001

Orthogroup ID

OG0000452

Physical Location & Seq

Genomic Coordinates Forward (+)

23096427 .. 23096663

Gene Structure 237 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug01G0169500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

ATGTTTGATCCCACAAAGATTGGCACAGTGAAACCTCCAAGAAAAGAGAAGCCAACAAAGGATGAGAAAGAGGCTGAGCTGGAAGCCGCTGTTAAAGTTGCCAAGGACATTGTCCCAAAGAATAAAACAAAGTGGAGGAGTAAGCCAAGTAAGATGAAGAAATTGCAGGAGATAATTGCCAATGTGAAGAGACCTTTCTTGGAACAACTAATGAAAAGGGGACAAACAAATGGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001763 GO:0003006 GO:0003674 GO:0003700 GO:0006355 GO:0007275 GO:0008150 GO:0009653 GO:0009791 GO:0009888 GO:0009889 GO:0009908 GO:0009933 GO:0009987 GO:0010014 GO:0010016 GO:0010223 GO:0010346 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0019827 GO:0022412 GO:0022414 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0032504 GO:0048367 GO:0048437 GO:0048438 GO:0048443 GO:0048466 GO:0048507 GO:0048532 GO:0048608 GO:0048646 GO:0048653 GO:0048731 GO:0048827 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0061458 GO:0065007 GO:0080090 GO:0080166 GO:0090506 GO:0090567 GO:0098727 GO:0099402 GO:0140110 GO:1903506 GO:1905393 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox

Protein Analysis

78

Amino Acids

8.96

Weight (kDa)

10.15

Isoelectric Point (pI)

41.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000452)

Species	Orthologous Gene IDs
rosa_rugosa	Rorug01G0066100 Rorug01G0066100 Rorug01G0069900 Rorug01G0089700 Rorug01G0090100 Rorug01G0097600 Rorug01G0099600 Rorug01G0101900 Rorug01G0102400 Rorug01G0118300 Rorug01G0124800 Rorug01G0169500 Rorug01G0238100 Rorug01G0451600 Rorug02G0188700 Rorug02G0229300 Rorug02G0253000 Rorug02G0256200 Rorug02G0258900 Rorug02G0339200 Rorug02G0392100 Rorug02G0491500 Rorug03G0141200 Rorug03G0192500 Rorug03G0200300 Rorug03G0218600 Rorug03G0269500 Rorug03G0269700 Rorug03G0272400 Rorug03G0276400 Rorug03G0283800 Rorug03G0334100 Rorug03G0356200 Rorug04G0002200 Rorug04G0008300 Rorug04G0031200 Rorug04G0040800 Rorug04G0063000 Rorug04G0069500.1 Rorug04G0070200 Rorug04G0114400 Rorug04G0181100 Rorug04G0205700 Rorug05G0004000 Rorug05G0018000 Rorug05G0018100 Rorug05G0090500 Rorug05G0108800 Rorug05G0118900 Rorug05G0202300 Rorug05G0214200 Rorug05G0243800 Rorug05G0243900 Rorug05G0266300 Rorug05G0272500 Rorug05G0276400 Rorug05G0291500 Rorug05G0293800 Rorug05G0350400 Rorug05G0360900 Rorug05G0369500 Rorug05G0370100 Rorug05G0370500 Rorug05G0407800 Rorug05G0418900 Rorug05G0524200 Rorug05G0526800 Rorug05G0547200 Rorug06G0004100 Rorug06G0015000 Rorug06G0027300 Rorug06G0048200 Rorug06G0059100 Rorug06G0066200 Rorug06G0128100 Rorug06G0363800.1 Rorug07G0031500 Rorug07G0184700 Rorug07G0185600 Rorug07G0189600 Rorug07G0196500 Rorug07G0200700 Rorug07G0219700 Rorug07G0219900 Rorug07G0219900 Rorug07G0223000 Rorug07G0223000 Rorug07G0230800 Rorug07G0243500 Rorug07G0244700 Rorug07G0245700 Rorug07G0279800 Rorug07G0305800

Species

Orthologous Gene IDs

rosa_rugosa

Rorug01G0066100 Rorug01G0066100 Rorug01G0069900 Rorug01G0089700 Rorug01G0090100 Rorug01G0097600 Rorug01G0099600 Rorug01G0101900 Rorug01G0102400 Rorug01G0118300 Rorug01G0124800 Rorug01G0169500 Rorug01G0238100 Rorug01G0451600 Rorug02G0188700 Rorug02G0229300 Rorug02G0253000 Rorug02G0256200 Rorug02G0258900 Rorug02G0339200 Rorug02G0392100 Rorug02G0491500 Rorug03G0141200 Rorug03G0192500 Rorug03G0200300 Rorug03G0218600 Rorug03G0269500 Rorug03G0269700 Rorug03G0272400 Rorug03G0276400 Rorug03G0283800 Rorug03G0334100 Rorug03G0356200 Rorug04G0002200 Rorug04G0008300 Rorug04G0031200 Rorug04G0040800 Rorug04G0063000 Rorug04G0069500.1 Rorug04G0070200 Rorug04G0114400 Rorug04G0181100 Rorug04G0205700 Rorug05G0004000 Rorug05G0018000 Rorug05G0018100 Rorug05G0090500 Rorug05G0108800 Rorug05G0118900 Rorug05G0202300 Rorug05G0214200 Rorug05G0243800 Rorug05G0243900 Rorug05G0266300 Rorug05G0272500 Rorug05G0276400 Rorug05G0291500 Rorug05G0293800 Rorug05G0350400 Rorug05G0360900 Rorug05G0369500 Rorug05G0370100 Rorug05G0370500 Rorug05G0407800 Rorug05G0418900 Rorug05G0524200 Rorug05G0526800 Rorug05G0547200 Rorug06G0004100 Rorug06G0015000 Rorug06G0027300 Rorug06G0048200 Rorug06G0059100 Rorug06G0066200 Rorug06G0128100 Rorug06G0363800.1 Rorug07G0031500 Rorug07G0184700 Rorug07G0185600 Rorug07G0189600 Rorug07G0196500 Rorug07G0200700 Rorug07G0219700 Rorug07G0219900 Rorug07G0219900 Rorug07G0223000 Rorug07G0223000 Rorug07G0230800 Rorug07G0243500 Rorug07G0244700 Rorug07G0245700 Rorug07G0279800 Rorug07G0305800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	87
AclWI	GGATC	1 cut(s)	2
AluBI	AGCT	1 cut(s)	79
AluI	AGCT	1 cut(s)	79
Alw26I	GTCTC	1 cut(s)	184
AlwI	GGATC	1 cut(s)	2
BcoDI	GTCTC	1 cut(s)	184
BfaI	CTAG	1 cut(s)	235
BisI	GCNGC	1 cut(s)	87
BlpI	GCTNAGC	1 cut(s)	75
BlsI	GCNGC	1 cut(s)	88
Bpu1102I	GCTNAGC	1 cut(s)	75
BsaI	GGTCTC	1 cut(s)	184
BsaJI	CCNNGG	1 cut(s)	102
BseDI	CCNNGG	1 cut(s)	102
BseGI	GGATG	1 cut(s)	67
BseMII	CTCAG	1 cut(s)	66
BseRI	GAGGAG	1 cut(s)	151
BslFI	GGGAC	1 cut(s)	98
BsmAI	GTCTC	1 cut(s)	184
BsmFI	GGGAC	1 cut(s)	98
Bso31I	GGTCTC	1 cut(s)	184
Bsp143I	GATC	1 cut(s)	7
Bsp1720I	GCTNAGC	1 cut(s)	75
BspACI	CCGC	1 cut(s)	87
BspCNI	CTCAG	1 cut(s)	67
BspPI	GGATC	1 cut(s)	2
BspTNI	GGTCTC	1 cut(s)	184
BssECI	CCNNGG	1 cut(s)	102
BssMI	GATC	1 cut(s)	7
BssT1I	CCWWGG	1 cut(s)	102
Bst4CI	ACNGT	1 cut(s)	28
Bst6I	CTCTTC	1 cut(s)	182
BstDEI	CTNAG	1 cut(s)	75
BstF5I	GGATG	1 cut(s)	67
BstKTI	GATC	1 cut(s)	10
BstMAI	GTCTC	1 cut(s)	184
BstMBI	GATC	1 cut(s)	7
BtsCI	GGATG	1 cut(s)	67
BtsIMutI	CAGTG	1 cut(s)	33
CspCI	CAANNNNNGTGG	1 cut(s)	36
CviJI	RGCY	6 cut(s)	52, 74, 79, 86, 145, 234
CviKI_1	RGCY	6 cut(s)	52, 74, 79, 86, 145, 234
DdeI	CTNAG	1 cut(s)	75
DpnI	GATC	1 cut(s)	9
DpnII	GATC	1 cut(s)	7
Eam1104I	CTCTTC	1 cut(s)	182
EarI	CTCTTC	1 cut(s)	182
Eco130I	CCWWGG	1 cut(s)	102
Eco31I	GGTCTC	1 cut(s)	184
EcoT14I	CCWWGG	1 cut(s)	102
ErhI	CCWWGG	1 cut(s)	102
FaqI	GGGAC	1 cut(s)	98
Fnu4HI	GCNGC	1 cut(s)	87
FokI	GGATG	1 cut(s)	74
Fsp4HI	GCNGC	1 cut(s)	87
FspBI	CTAG	1 cut(s)	235
GluI	GCNGC	1 cut(s)	87
HpyCH4III	ACNGT	1 cut(s)	28
HpyCH4V	TGCA	1 cut(s)	166
HpyF3I	CTNAG	1 cut(s)	75
Kzo9I	GATC	1 cut(s)	7
LpnPI	CCDG	2 cut(s)	65, 152
MaeI	CTAG	1 cut(s)	235
MalI	GATC	1 cut(s)	9
MboI	GATC	1 cut(s)	7
MboII	GAAGA	2 cut(s)	169, 199
MluCI	AATT	2 cut(s)	161, 174
MnlI	CCTC	3 cut(s)	45, 64, 129
MseI	TTAA	1 cut(s)	93
MspA1I	CMGCKG	1 cut(s)	89
NdeII	GATC	1 cut(s)	7
PflFI	GACNNNGTC	1 cut(s)	110
PkrI	GCNGC	1 cut(s)	88
PsyI	GACNNNGTC	1 cut(s)	110
SaqAI	TTAA	1 cut(s)	93
SatI	GCNGC	1 cut(s)	87
Sau3AI	GATC	1 cut(s)	7
SetI	ASST	3 cut(s)	37, 81, 196
SgeI	CNNG	6 cut(s)	51, 92, 115, 159, 179, 211
Sse9I	AATT	2 cut(s)	161, 174
SsiI	CCGC	1 cut(s)	87
SspMI	CTAG	1 cut(s)	235
StyI	CCWWGG	1 cut(s)	102
TaaI	ACNGT	1 cut(s)	28
TasI	AATT	2 cut(s)	161, 174
TauI	GCSGC	1 cut(s)	89
Tru1I	TTAA	1 cut(s)	93
Tru9I	TTAA	1 cut(s)	93
TscAI	CASTG	1 cut(s)	33
TspDTI	ATGAA	2 cut(s)	170, 227
TspRI	CASTG	1 cut(s)	33
Tth111I	GACNNNGTC	1 cut(s)	110
XspI	CTAG	1 cut(s)	235

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.