Rh6CG321300

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000429
Physical Location & Seq
Forward (+)
50682017 .. 50687341
5325 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG321300.1

Sequence Viewer

Length: 267 bp
ATGGAGTGGGAATGTTTTTCACAGGCACAGACAATAACTCTTAATGGGAAGCTAAGCAGTGCGGAGGACAGAGTTGCGGCAAACAAAAAGGTTTCAAGGATGTCTGTCACCAGCGTCATCCTTCCTTCTGGAAACTGCCACATTGAACCTGCAAAAGCACTTCTTGTTGAGGACTGCAGTAATAGAGATTCTATATATACAAAGACTTTCCTAGCACCTATAGAACAGATATTCTGGAGGGATGAGTGGTATAAGCTCCAGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

88

Amino Acids

10.04

Weight (kDa)

5.75

Isoelectric Point (pI)

63.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000429)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g11330 FvH4_2g11330 FvH4_2g21630 FvH4_2g21630 FvH4_2g21630 FvH4_2g21630 FvH4_2g21772 FvH4_2g21772 FvH4_2g21773 FvH4_2g21774
malus_domestica MD05G1199100.v1.1 MD05G1200000.v1.1 MD05G1201900.v1.1 MD10G1188800.v1.1 MD10G1189600.v1.1 MD10G1189900.v1.1 MD15G1001500.v1.1
prunus_persica Prupe.1G354100_v2.0.a1 Prupe.1G354100_v2.0.a1 Prupe.1G354100_v2.0.a1 Prupe.1G354100_v2.0.a1 Prupe.1G354100_v2.0.a1 Prupe.8G224200_v2.0.a1 Prupe.8G225800_v2.0.a1
pyrus_communis pycom05g18530 pycom05g18630 pycom05g18650 pycom05g18870 pycom15g00070
rosa_chinensis RchiOBHm_Chr4g0407601 RchiOBHm_Chr6g0288311 RchiOBHm_Chr6g0288451 RchiOBHm_Chr6g0288461 RchiOBHm_Chr6g0288471 RchiOBHm_Chr6g0288491 RchiOBHm_Chr6g0288511 RchiOBHm_Chr6g0288521 RchiOBHm_Chr7g0188451
rosa_laevigata RLG00000004695 RLG00000008705 RLG00000010120 RLG00000012396 RLG00000012402 RLG00000012416 RLG00000017369
rosa_multiflora Rmu_co8451481.1_g000001 Rmu_co8483209.1_g000001 Rmu_sc0000952.1_g000001 Rmu_sc0001038.1_g000007 Rmu_sc0004806.1_g000002 Rmu_sc0006439.1_g000001 Rmu_sc0011657.1_g000015
rosa_roxburghii Rroxscaffold_3G00266420 Rroxscaffold_5G00334150 Rroxscaffold_5G00352210 Rroxscaffold_7G00180010 Rroxscaffold_7G00180020 Rroxscaffold_7G00180030 Rroxscaffold_7G00180040 Rroxscaffold_7G00180180
rosa_rugosa Rorug04G0080800 Rorug05G0399800 Rorug06G0195400 Rorug06G0195400 Rorug06G0195600 Rorug06G0196500 Rorug06G0196600 Rorug06G0490400
rosa_samantha Rh2BG181900 Rh2DG180700 Rh4AG145500 Rh4BG143300 Rh4CG152200 Rh6AG306700 Rh6AG308200 Rh6AG308300 Rh6AG308500 Rh6AG308600 Rh6BG312500 Rh6BG313400 Rh6BG313800 Rh6BG313900 Rh6CG321300 Rh6DG305500 Rh6DG306700 Rh6DG306800 Rh6DG306900 Rh6DG307100 Rh7AG095200 Rh7BG096700 Rh7CG097500
rosa_wichuraiana Rw4G011820 Rw6G026520 Rw6G026640 Rw6G026650 Rw7G008210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 157
AciI CCGC 2 cut(s) 62, 77
AgsI TTSAA 2 cut(s) 96, 146
AluBI AGCT 2 cut(s) 52, 256
AluI AGCT 2 cut(s) 52, 256
AsuHPI GGTGA 1 cut(s) 100
BfaI CTAG 1 cut(s) 212
BfmI CTRYAG 2 cut(s) 175, 219
BfuAI ACCTGC 1 cut(s) 157
BisI GCNGC 1 cut(s) 78
BlpI GCTNAGC 1 cut(s) 53
BlsI GCNGC 1 cut(s) 79
BpmI CTGGAG 2 cut(s) 242, 256
Bpu1102I GCTNAGC 1 cut(s) 53
BseGI GGATG 3 cut(s) 105, 117, 247
Bsp1720I GCTNAGC 1 cut(s) 53
BspACI CCGC 2 cut(s) 62, 77
BspMAI CTGCAG 1 cut(s) 179
BspMI ACCTGC 1 cut(s) 157
BstDEI CTNAG 1 cut(s) 53
BstF5I GGATG 3 cut(s) 105, 117, 247
BstSFI CTRYAG 2 cut(s) 175, 219
BtsCI GGATG 3 cut(s) 105, 117, 247
BtsI GCAGTG 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 64
BveI ACCTGC 1 cut(s) 157
CseI GACGC 1 cut(s) 103
CviJI RGCY 3 cut(s) 52, 256, 262
CviKI_1 RGCY 3 cut(s) 52, 256, 262
DdeI CTNAG 1 cut(s) 53
FaiI YATR 5 cut(s) 194, 196, 198, 221, 252
FalI AAGNNNNNCTT 2 cut(s) 147, 179
Fnu4HI GCNGC 1 cut(s) 78
FokI GGATG 3 cut(s) 104, 112, 254
Fsp4HI GCNGC 1 cut(s) 78
FspBI CTAG 1 cut(s) 212
GluI GCNGC 1 cut(s) 78
GsuI CTGGAG 2 cut(s) 242, 256
HgaI GACGC 1 cut(s) 103
HinfI GANTC 1 cut(s) 188
HphI GGTGA 1 cut(s) 100
Hpy188III TCNNGA 2 cut(s) 129, 235
HpyAV CCTTC 2 cut(s) 131, 135
HpyCH4V TGCA 2 cut(s) 152, 177
HpyF3I CTNAG 1 cut(s) 53
LmnI GCTCC 1 cut(s) 261
LpnPI CCDG 5 cut(s) 8, 114, 124, 162, 220
MaeI CTAG 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 106
MnlI CCTC 3 cut(s) 58, 163, 231
MseI TTAA 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 188
PkrI GCNGC 1 cut(s) 79
PstI CTGCAG 1 cut(s) 179
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 1 cut(s) 78
SetI ASST 5 cut(s) 54, 93, 151, 220, 258
SfcI CTRYAG 2 cut(s) 175, 219
SgeI CNNG 8 cut(s) 35, 108, 123, 141, 161, 176, 224, 247
SsiI CCGC 2 cut(s) 62, 77
SspMI CTAG 1 cut(s) 212
TauI GCSGC 1 cut(s) 80
TfiI GAWTC 1 cut(s) 188
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 64
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspRI CASTG 1 cut(s) 64
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.