RLG00000022642

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
6124622 .. 6135664
11043 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022642

Sequence Viewer

Length: 345 bp
ATGTACACTGCTTACCCAAAGACCACATCTGAATTAGAACTACAAGGTTCAGGTCCTTTTAAGAAGAAAGGTAGAGGGGGAGCTAAGGGTGAAAAAGGACATGACATGCCAGCTGATATATATGACGGAAGGATCATAATCCCTCAAGCAATACGTGCAATATTCCCACTCTTCAAGCAAGAATTGATTGGGCCATATACAACATGGCCTCAATACAAAAACCAAGGAAAGAACTTGACCAGGGTGTATGAAAGTTGGCAAGAATTTAACTTCAAATTCACATGCTCTGAAGAAGATGTAAAGGATGCATTTGAAAAGCATATTGAAAATCAATATCTAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

13.22

Weight (kDa)

6.74

Isoelectric Point (pI)

35.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000450)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20080 FvH4_1g23272 FvH4_1g24190 FvH4_1g24191 FvH4_2g16992 FvH4_4g20600 FvH4_5g37430 FvH4_6g13850 FvH4_6g23331 FvH4_7g07732
prunus_persica Prupe.2G062800_v2.0.a1 Prupe.7G020400_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0159341 RchiOBHm_Chr3g0461151 RchiOBHm_Chr3g0471341 RchiOBHm_Chr5g0079051
rosa_laevigata RLG00000013771 RLG00000016694 RLG00000019616 RLG00000020143 RLG00000022642 RLG00000030165
rosa_multiflora Rmu_sc0000058.1_g000010 Rmu_sc0000898.1_g000045 Rmu_sc0001200.1_g000007 Rmu_sc0001200.1_g000008 Rmu_sc0001323.1_g000001 Rmu_sc0002194.1_g000008 Rmu_sc0002206.1_g000017 Rmu_sc0002230.1_g000001 Rmu_sc0002280.1_g000001 Rmu_sc0003047.1_g000022 Rmu_sc0003623.1_g000007 Rmu_sc0003835.1_g000012
rosa_roxburghii Rroxscaffold_1G00019590 Rroxscaffold_1G00029010 Rroxscaffold_1G00029250 Rroxscaffold_1G00031650 Rroxscaffold_1G00031660 Rroxscaffold_1G00052850 Rroxscaffold_2G00144000 Rroxscaffold_3G00231810 Rroxscaffold_3G00245070 Rroxscaffold_3G00268690 Rroxscaffold_4G00312920 Rroxscaffold_5G00350060 Rroxscaffold_6G00412590 Rroxscaffold_6G00412600 Rroxscaffold_6G00420320 Rroxscaffold_7G00192970 Rroxscaffold_7G00197810 Rroxscaffold_7G00208250
rosa_rugosa Rorug01G0074000 Rorug01G0273600.1 Rorug01G0273700 Rorug03G0275700 Rorug04G0060600 Rorug04G0063100 Rorug04G0170400 Rorug05G0185600 Rorug05G0224200 Rorug05G0234600
rosa_samantha Rh1CG227300 Rh1DG133300 Rh1DG133400 Rh2AG004600 Rh2BG038900 Rh3BG045400 Rh3BG359100 Rh3BG359200 Rh3CG044000 Rh3CG355700 Rh4CG188000 Rh4CG217400 Rh4DG018500 Rh4DG092800 Rh4DG128600 Rh4DG141700 Rh5CG305800 Rh5DG275100 Rh5DG430600 Rh6DG316100
rosa_wichuraiana Rw0G005510 Rw0G010440 Rw0G010450 Rw1G018670 Rw3G028280 Rw4G010530 Rw4G010930 Rw4G012110 Rw4G012720 Rw5G007170 Rw7G023020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 2 cut(s) 263, 275
AcuI CTGAAG 1 cut(s) 309
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 4 cut(s) 175, 274, 314, 326
AjnI CCWGG 1 cut(s) 239
AluBI AGCT 2 cut(s) 83, 113
AluI AGCT 2 cut(s) 83, 113
AlwI GGATC 1 cut(s) 140
AoxI GGCC 2 cut(s) 191, 206
ApoI RAATTY 2 cut(s) 263, 275
AspS9I GGNCC 2 cut(s) 53, 191
AsuHPI GGTGA 1 cut(s) 101
AvaII GGWCC 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 241
BfaI CTAG 2 cut(s) 338, 343
Bme1390I CCNGG 1 cut(s) 241
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 2 cut(s) 53, 191
BmrFI CCNGG 1 cut(s) 241
BmsI GCATC 1 cut(s) 295
Bpu10I CCTNAGC 1 cut(s) 84
BpuEI CTTGAG 1 cut(s) 129
BsaAI YACGTR 1 cut(s) 155
BsaBI GATNNNNATC 1 cut(s) 137
BsaJI CCNNGG 2 cut(s) 223, 240
Bse8I GATNNNNATC 1 cut(s) 137
BseBI CCWGG 1 cut(s) 241
BseDI CCNNGG 2 cut(s) 223, 240
BseGI GGATG 1 cut(s) 310
BseJI GATNNNNATC 1 cut(s) 137
BshFI GGCC 2 cut(s) 193, 208
BsnI GGCC 2 cut(s) 193, 208
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 1 cut(s) 132
BspANI GGCC 2 cut(s) 193, 208
BspPI GGATC 1 cut(s) 140
BsrGI TGTACA 1 cut(s) 3
BssECI CCNNGG 2 cut(s) 223, 240
BssMI GATC 1 cut(s) 132
BssT1I CCWWGG 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 241
Bst6I CTCTTC 1 cut(s) 176
BstAPI GCANNNNNTGC 1 cut(s) 155
BstAUI TGTACA 1 cut(s) 3
BstBAI YACGTR 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 84
BstF5I GGATG 1 cut(s) 310
BstKTI GATC 1 cut(s) 135
BstMBI GATC 1 cut(s) 132
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNI CCWGG 1 cut(s) 241
BstNSI RCATGY 2 cut(s) 109, 285
BstSCI CCNGG 1 cut(s) 239
BsuRI GGCC 2 cut(s) 193, 208
BtsCI GGATG 1 cut(s) 310
BtsI GCAGTG 1 cut(s) 6
BtsIMutI CAGTG 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 111
Cfr13I GGNCC 2 cut(s) 53, 191
Csp6I GTAC 1 cut(s) 4
CviAII CATG 4 cut(s) 101, 106, 204, 282
CviJI RGCY 4 cut(s) 83, 113, 193, 208
CviKI_1 RGCY 4 cut(s) 83, 113, 193, 208
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 84
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
Eam1104I CTCTTC 1 cut(s) 176
EarI CTCTTC 1 cut(s) 176
Eco130I CCWWGG 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 309
EcoO109I RGGNCCY 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 239
EcoT14I CCWWGG 1 cut(s) 223
EcoT22I ATGCAT 1 cut(s) 310
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 4 cut(s) 104, 109, 207, 285
FatI CATG 4 cut(s) 100, 105, 203, 281
FokI GGATG 1 cut(s) 317
FspBI CTAG 2 cut(s) 338, 343
HaeIII GGCC 2 cut(s) 193, 208
Hin1II CATG 4 cut(s) 104, 109, 207, 285
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 31, 289
Hpy188III TCNNGA 1 cut(s) 338
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 123
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 158, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 4 cut(s) 104, 109, 207, 285
Kzo9I GATC 1 cut(s) 132
LmnI GCTCC 1 cut(s) 80
LpnPI CCDG 4 cut(s) 36, 123, 226, 253
LweI GCATC 1 cut(s) 295
MaeI CTAG 2 cut(s) 338, 343
MaeII ACGT 1 cut(s) 154
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MboII GAAGA 4 cut(s) 76, 163, 302, 305
MluCI AATT 4 cut(s) 32, 182, 263, 275
MnlI CCTC 3 cut(s) 68, 153, 219
Mph1103I ATGCAT 1 cut(s) 310
MseI TTAA 2 cut(s) 60, 267
MspA1I CMGCKG 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 241
MvaI CCWGG 1 cut(s) 241
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 132
NlaIII CATG 4 cut(s) 104, 109, 207, 285
NsiI ATGCAT 1 cut(s) 310
NspI RCATGY 2 cut(s) 109, 285
Ppu21I YACGTR 1 cut(s) 155
PpuMI RGGWCCY 1 cut(s) 53
Psp5II RGGWCCY 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 239
PspGI CCWGG 1 cut(s) 239
PspPI GGNCC 2 cut(s) 53, 191
PspPPI RGGWCCY 1 cut(s) 53
PvuII CAGCTG 1 cut(s) 113
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 60, 267
Sau3AI GATC 1 cut(s) 132
Sau96I GGNCC 2 cut(s) 53, 191
ScrFI CCNGG 1 cut(s) 241
SetI ASST 6 cut(s) 49, 55, 73, 85, 115, 157
SfaNI GCATC 1 cut(s) 295
SinI GGWCC 1 cut(s) 53
SmlI CTYRAG 1 cut(s) 144
SmoI CTYRAG 1 cut(s) 144
Sse9I AATT 4 cut(s) 32, 182, 263, 275
SspI AATATT 1 cut(s) 162
SspMI CTAG 2 cut(s) 338, 343
StyD4I CCNGG 1 cut(s) 239
StyI CCWWGG 1 cut(s) 223
TaiI ACGT 1 cut(s) 157
TasI AATT 4 cut(s) 32, 182, 263, 275
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 2 cut(s) 60, 267
Tru9I TTAA 2 cut(s) 60, 267
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 264
TspGWI ACGGA 1 cut(s) 141
TspRI CASTG 1 cut(s) 13
VpaK11BI GGWCC 1 cut(s) 53
XapI RAATTY 2 cut(s) 263, 275
XbaI TCTAGA 1 cut(s) 337
XceI RCATGY 2 cut(s) 109, 285
XcmI CCANNNNNNNNNTGG 1 cut(s) 201
XspI CTAG 2 cut(s) 338, 343
Zsp2I ATGCAT 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.