Rmu_sc0003623.1_g000007

Transposase family tnp2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003623.1
Physical Location & Seq
Forward (+)
27052 .. 27456
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003623.1_g000007.1.cds

Sequence Viewer

Length: 405 bp
atggtgaaaggagagaaccaaattgagggcgaagtgccttggtatggaacaataaaagacattattgagttgcggtatacaaagaggaatagggttgtcttgttcaattgtaattggtatgacacggccacagagcggactggttataaggtggatcggaatgggatagtaagtgttaatacacgagccaagctaaatactgatgaaccatttgtgctagttgaccatgcaactcaagtttattacattcaggaaataaaaaatagtgcatggagtgttgtggtggaaacaaaacctagaaacatttttgagatgcctgcaaatgaaggtgaaccatctcaagaagaagaagctcagcatggttacacacatgataatcaaaatgaggacgaagatttggaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

134

Amino Acids

15.61

Weight (kDa)

4.7

Isoelectric Point (pI)

32.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000450)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20080 FvH4_1g23272 FvH4_1g24190 FvH4_1g24191 FvH4_2g16992 FvH4_4g20600 FvH4_5g37430 FvH4_6g13850 FvH4_6g23331 FvH4_7g07732
prunus_persica Prupe.2G062800_v2.0.a1 Prupe.7G020400_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0159341 RchiOBHm_Chr3g0461151 RchiOBHm_Chr3g0471341 RchiOBHm_Chr5g0079051
rosa_laevigata RLG00000013771 RLG00000016694 RLG00000019616 RLG00000020143 RLG00000022642 RLG00000030165
rosa_multiflora Rmu_sc0000058.1_g000010 Rmu_sc0000898.1_g000045 Rmu_sc0001200.1_g000007 Rmu_sc0001200.1_g000008 Rmu_sc0001323.1_g000001 Rmu_sc0002194.1_g000008 Rmu_sc0002206.1_g000017 Rmu_sc0002230.1_g000001 Rmu_sc0002280.1_g000001 Rmu_sc0003047.1_g000022 Rmu_sc0003623.1_g000007 Rmu_sc0003835.1_g000012
rosa_roxburghii Rroxscaffold_1G00019590 Rroxscaffold_1G00029010 Rroxscaffold_1G00029250 Rroxscaffold_1G00031650 Rroxscaffold_1G00031660 Rroxscaffold_1G00052850 Rroxscaffold_2G00144000 Rroxscaffold_3G00231810 Rroxscaffold_3G00245070 Rroxscaffold_3G00268690 Rroxscaffold_4G00312920 Rroxscaffold_5G00350060 Rroxscaffold_6G00412590 Rroxscaffold_6G00412600 Rroxscaffold_6G00420320 Rroxscaffold_7G00192970 Rroxscaffold_7G00197810 Rroxscaffold_7G00208250
rosa_rugosa Rorug01G0074000 Rorug01G0273600.1 Rorug01G0273700 Rorug03G0275700 Rorug04G0060600 Rorug04G0063100 Rorug04G0170400 Rorug05G0185600 Rorug05G0224200 Rorug05G0234600
rosa_samantha Rh1CG227300 Rh1DG133300 Rh1DG133400 Rh2AG004600 Rh2BG038900 Rh3BG045400 Rh3BG359100 Rh3BG359200 Rh3CG044000 Rh3CG355700 Rh4CG188000 Rh4CG217400 Rh4DG018500 Rh4DG092800 Rh4DG128600 Rh4DG141700 Rh5CG305800 Rh5DG275100 Rh5DG430600 Rh6DG316100
rosa_wichuraiana Rw0G005510 Rw0G010440 Rw0G010450 Rw1G018670 Rw3G028280 Rw4G010530 Rw4G010930 Rw4G012110 Rw4G012720 Rw5G007170 Rw7G023020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 147
AccBSI CCGCTC 1 cut(s) 136
AccI GTMKAC 1 cut(s) 77
AciI CCGC 2 cut(s) 73, 136
AclWI GGATC 1 cut(s) 162
AcoI YGGCCR 1 cut(s) 126
AfiI CCNNNNNNNGG 3 cut(s) 25, 44, 135
AgsI TTSAA 1 cut(s) 106
AluBI AGCT 2 cut(s) 193, 353
AluI AGCT 2 cut(s) 193, 353
AlwI GGATC 1 cut(s) 162
AoxI GGCC 1 cut(s) 126
AsuHPI GGTGA 2 cut(s) 16, 341
BauI CACGAG 1 cut(s) 183
BccI CCATC 1 cut(s) 343
BceAI ACGGC 1 cut(s) 141
BfaI CTAG 2 cut(s) 218, 297
BlpI GCTNAGC 1 cut(s) 354
BmsI GCATC 1 cut(s) 303
Bpu1102I GCTNAGC 1 cut(s) 354
BpuEI CTTGAG 2 cut(s) 219, 324
BsaJI CCNNGG 1 cut(s) 38
Bsc4I CCNNNNNNNGG 3 cut(s) 25, 44, 135
Bse1I ACTGG 1 cut(s) 145
BseDI CCNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 3 cut(s) 25, 44, 135
BseMII CTCAG 1 cut(s) 368
BseNI ACTGG 1 cut(s) 145
BshFI GGCC 1 cut(s) 128
BslI CCNNNNNNNGG 3 cut(s) 25, 44, 135
BsnI GGCC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 154
Bsp1720I GCTNAGC 1 cut(s) 354
BspACI CCGC 2 cut(s) 73, 136
BspANI GGCC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 367
BspPI GGATC 1 cut(s) 162
BsrBI CCGCTC 1 cut(s) 136
BsrI ACTGG 1 cut(s) 145
BssECI CCNNGG 1 cut(s) 38
BssMI GATC 1 cut(s) 154
BssNAI GTATAC 1 cut(s) 78
BssSI CACGAG 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 38
Bst1107I GTATAC 1 cut(s) 78
Bst2BI CACGAG 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 318
BstDEI CTNAG 1 cut(s) 354
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstZ17I GTATAC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 318
CviAII CATG 4 cut(s) 227, 270, 359, 371
CviJI RGCY 4 cut(s) 128, 188, 193, 353
CviKI_1 RGCY 4 cut(s) 128, 188, 193, 353
DdeI CTNAG 1 cut(s) 354
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
EaeI YGGCCR 1 cut(s) 126
Eco130I CCWWGG 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 38
ErhI CCWWGG 1 cut(s) 38
FaeI CATG 4 cut(s) 230, 273, 362, 374
FaiI YATR 8 cut(s) 45, 78, 120, 147, 228, 271, 360, 372
FatI CATG 4 cut(s) 226, 269, 358, 370
FblI GTMKAC 1 cut(s) 77
FspBI CTAG 2 cut(s) 218, 297
HaeIII GGCC 1 cut(s) 128
Hin1II CATG 4 cut(s) 230, 273, 362, 374
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HphI GGTGA 2 cut(s) 16, 341
Hpy166II GTNNAC 3 cut(s) 78, 223, 332
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 2 cut(s) 251, 341
Hpy8I GTNNAC 3 cut(s) 78, 223, 332
HpyAV CCTTC 1 cut(s) 320
HpyCH4V TGCA 3 cut(s) 230, 269, 320
HpyF3I CTNAG 1 cut(s) 354
Hsp92II CATG 4 cut(s) 230, 273, 362, 374
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 3 cut(s) 126, 236, 330
LweI GCATC 1 cut(s) 303
MaeI CTAG 2 cut(s) 218, 297
MaeIII GTNAC 1 cut(s) 362
MalI GATC 1 cut(s) 156
MbiI CCGCTC 1 cut(s) 136
MboI GATC 1 cut(s) 154
MboII GAAGA 3 cut(s) 356, 359, 404
MfeI CAATTG 1 cut(s) 106
MluCI AATT 3 cut(s) 21, 106, 112
MnlI CCTC 3 cut(s) 19, 78, 379
MseI TTAA 1 cut(s) 177
MunI CAATTG 1 cut(s) 106
NdeII GATC 1 cut(s) 154
NlaIII CATG 4 cut(s) 230, 273, 362, 374
PsiI TTATAA 1 cut(s) 147
SaqAI TTAA 1 cut(s) 177
Sau3AI GATC 1 cut(s) 154
SetI ASST 5 cut(s) 153, 195, 298, 331, 355
SfaNI GCATC 1 cut(s) 303
SmlI CTYRAG 2 cut(s) 234, 339
SmoI CTYRAG 2 cut(s) 234, 339
Sse9I AATT 3 cut(s) 21, 106, 112
SsiI CCGC 2 cut(s) 73, 136
SspMI CTAG 2 cut(s) 218, 297
StyI CCWWGG 1 cut(s) 38
TasI AATT 3 cut(s) 21, 106, 112
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TspDTI ATGAA 2 cut(s) 219, 339
XmiI GTMKAC 1 cut(s) 77
XspI CTAG 2 cut(s) 218, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.