Rh5DG430600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0000450
Physical Location & Seq
Reverse (-)
68843880 .. 68844750
871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG430600.1

Sequence Viewer

Length: 225 bp
ATGGCAGTCAGCGGAACAGAAGATATCACTACATTTATCACTGATAATGAAAAACAACAGACCGGTCCTCCTAAGAAGAAAGGTAGAGGGGGAGCTAAGGGTGAAAAGGGACATGGCATGCTAGTTGATATACATGACGGAAGATGTAAGAAGATTGAAATAATCTCACAAGGGGTCATATCAAGTTTATCCCGACTTGAAGAGTGTATATGTGGTCAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

7.93

Weight (kDa)

7.73

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000450)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20080 FvH4_1g23272 FvH4_1g24190 FvH4_1g24191 FvH4_2g16992 FvH4_4g20600 FvH4_5g37430 FvH4_6g13850 FvH4_6g23331 FvH4_7g07732
prunus_persica Prupe.2G062800_v2.0.a1 Prupe.7G020400_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0159341 RchiOBHm_Chr3g0461151 RchiOBHm_Chr3g0471341 RchiOBHm_Chr5g0079051
rosa_laevigata RLG00000013771 RLG00000016694 RLG00000019616 RLG00000020143 RLG00000022642 RLG00000030165
rosa_multiflora Rmu_sc0000058.1_g000010 Rmu_sc0000898.1_g000045 Rmu_sc0001200.1_g000007 Rmu_sc0001200.1_g000008 Rmu_sc0001323.1_g000001 Rmu_sc0002194.1_g000008 Rmu_sc0002206.1_g000017 Rmu_sc0002230.1_g000001 Rmu_sc0002280.1_g000001 Rmu_sc0003047.1_g000022 Rmu_sc0003623.1_g000007 Rmu_sc0003835.1_g000012
rosa_roxburghii Rroxscaffold_1G00019590 Rroxscaffold_1G00029010 Rroxscaffold_1G00029250 Rroxscaffold_1G00031650 Rroxscaffold_1G00031660 Rroxscaffold_1G00052850 Rroxscaffold_2G00144000 Rroxscaffold_3G00231810 Rroxscaffold_3G00245070 Rroxscaffold_3G00268690 Rroxscaffold_4G00312920 Rroxscaffold_5G00350060 Rroxscaffold_6G00412590 Rroxscaffold_6G00412600 Rroxscaffold_6G00420320 Rroxscaffold_7G00192970 Rroxscaffold_7G00197810 Rroxscaffold_7G00208250
rosa_rugosa Rorug01G0074000 Rorug01G0273600.1 Rorug01G0273700 Rorug03G0275700 Rorug04G0060600 Rorug04G0063100 Rorug04G0170400 Rorug05G0185600 Rorug05G0224200 Rorug05G0234600
rosa_samantha Rh1CG227300 Rh1DG133300 Rh1DG133400 Rh2AG004600 Rh2BG038900 Rh3BG045400 Rh3BG359100 Rh3BG359200 Rh3CG044000 Rh3CG355700 Rh4CG188000 Rh4CG217400 Rh4DG018500 Rh4DG092800 Rh4DG128600 Rh4DG141700 Rh5CG305800 Rh5DG275100 Rh5DG430600 Rh6DG316100
rosa_wichuraiana Rw0G005510 Rw0G010440 Rw0G010450 Rw1G018670 Rw3G028280 Rw4G010530 Rw4G010930 Rw4G012110 Rw4G012720 Rw5G007170 Rw7G023020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 12
AgeI ACCGGT 1 cut(s) 62
AgsI TTSAA 2 cut(s) 158, 200
AluBI AGCT 2 cut(s) 95, 220
AluI AGCT 2 cut(s) 95, 220
AsiGI ACCGGT 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 113
AvaII GGWCC 1 cut(s) 65
BfaI CTAG 1 cut(s) 122
Bme18I GGWCC 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 65
Bpu10I CCTNAGC 1 cut(s) 96
BsaWI WCCGGW 1 cut(s) 62
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bse118I RCCGGY 1 cut(s) 62
BshTI ACCGGT 1 cut(s) 62
BsiSI CCGG 1 cut(s) 63
BslFI GGGAC 1 cut(s) 123
BsmFI GGGAC 1 cut(s) 123
BspACI CCGC 1 cut(s) 12
BsrFI RCCGGY 1 cut(s) 62
BssAI RCCGGY 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 195
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 2 cut(s) 72, 96
BstNSI RCATGY 1 cut(s) 121
BtsIMutI CAGTG 1 cut(s) 39
Cac8I GCNNGC 1 cut(s) 119
Cfr10I RCCGGY 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 65
CspAI ACCGGT 1 cut(s) 62
CviAII CATG 3 cut(s) 113, 118, 134
CviJI RGCY 2 cut(s) 95, 220
CviKI_1 RGCY 2 cut(s) 95, 220
DdeI CTNAG 2 cut(s) 72, 96
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco32I GATATC 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 65
EcoRV GATATC 1 cut(s) 25
FaeI CATG 3 cut(s) 116, 121, 137
FaiI YATR 7 cut(s) 114, 119, 131, 135, 179, 209, 211
FaqI GGGAC 1 cut(s) 123
FatI CATG 3 cut(s) 112, 117, 133
FspBI CTAG 1 cut(s) 122
HapII CCGG 1 cut(s) 63
Hin1II CATG 3 cut(s) 116, 121, 137
HpaII CCGG 1 cut(s) 63
HphI GGTGA 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 192
HpyF3I CTNAG 2 cut(s) 72, 96
Hsp92II CATG 3 cut(s) 116, 121, 137
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 1 cut(s) 76
MaeI CTAG 1 cut(s) 122
MboII GAAGA 5 cut(s) 32, 88, 153, 163, 212
MnlI CCTC 2 cut(s) 78, 80
MspA1I CMGCKG 1 cut(s) 12
MspI CCGG 1 cut(s) 63
NlaIII CATG 3 cut(s) 116, 121, 137
NspI RCATGY 1 cut(s) 121
PaeI GCATGC 1 cut(s) 121
PinAI ACCGGT 1 cut(s) 62
PspPI GGNCC 1 cut(s) 65
Sau96I GGNCC 1 cut(s) 65
SetI ASST 3 cut(s) 85, 97, 222
SgeI CNNG 9 cut(s) 75, 125, 130, 134, 146, 182, 195, 204, 209
SinI GGWCC 1 cut(s) 65
SphI GCATGC 1 cut(s) 121
SsiI CCGC 1 cut(s) 12
SspMI CTAG 1 cut(s) 122
TscAI CASTG 1 cut(s) 46
TspDTI ATGAA 1 cut(s) 63
TspGWI ACGGA 1 cut(s) 153
TspRI CASTG 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 65
XceI RCATGY 1 cut(s) 121
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.