Rmu_sc0000927.1_g000006

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000927.1
Physical Location & Seq
Forward (+)
54224 .. 57737
3514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000927.1_g000006.1.cds

Sequence Viewer

Length: 1092 bp
atgacgagattctcgttaggcggagatgaagatggagaaggaccgagcagccccaggcagaagagacgtcgtcttgttcttcggacagctgctactgtggccataggggaacgaggaggaggagggctacaggctgttgaggacgaatcatcatcagaagaagaggaggaagaagaagaagaagaagaagaagaaagtgattcagaagaagaagaagaaactgaaggtgatgaattcgtaacactcgagtcgccgaggaccagcatcgaattgggttctgcctcggcagctcaagagactgctcttgcttccaccacggataggtctatttccatcaccttgaccgaccccgatgtgcttgattgtcccatttgctgtgaatccttgaccgtccccgtcttccagtgtgaaaatggtcatatagcttgctcctcctgcagcacaaagattaaaaataaatgtccttcatgttcctggcccattggttataatcgttgtcgtgccattgagaaagttctagaatcaattagaatgtcatgccaaaacatcaagtatggttgcaaagaacggatgacgtgcaataataaaaatgaacatgaaaaggcatgtatgcattcaccttgttcatgccctcattcaggctgcaactttgtctcttcaacgaagaagttataccaacatttcagcagtaatcatttgaactctgcaacacatttcctgtacaacagcagcttttcaattacaataaactttaatgacaaatttcttgttcttcaagaacagaatgatggcatattatttatccttgacaacacaactgaaattctaggaaatatggtgaggcttagttgtattcaacctagatttatgggaggctttttctatgatcttactgctaaaaccaagggatgtttactcagattacagtccatcacaaacagtactccaagccattgtcatagccctacttcatctcgctcccttataatcccaggtgattttttcagttcttgtggccagctcaagatggatatctgcatatggcgtaatggtcagttccctccgtccttccaatctatcaatgttacttaa

Protein Analysis

363

Amino Acids

40.23

Weight (kDa)

4.94

Isoelectric Point (pI)

78.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000395)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G66610 AT1G66610 AT1G66620 AT1G66630 AT1G66650 AT1G66660 AT1G66660 AT5G37870 AT5G37890 AT5G37900 AT5G37910 AT5G37930 AT5G62800 AT5G62800
fragaria_vesca FvH4_1g29100 FvH4_1g29100 FvH4_1g29100 FvH4_1g29100 FvH4_1g29100 FvH4_1g29100 FvH4_1g29100 FvH4_2g03850 FvH4_2g04470 FvH4_2g04471
malus_domestica MD09G1260200.v1.1 MD09G1260400.v1.1 MD10G1106400.v1.1
prunus_persica Prupe.3G152000_v2.0.a1 Prupe.3G152100_v2.0.a1 Prupe.3G152100_v2.0.a1 Prupe.3G152100_v2.0.a1 Prupe.8G145400_v2.0.a1 Prupe.8G145500_v2.0.a1
pyrus_communis pycom09g17480 pycom09g17490 pycom10g09160
rosa_chinensis RchiOBHm_Chr2g0111691 RchiOBHm_Chr3g0448681 RchiOBHm_Chr3g0493571 RchiOBHm_Chr6g0252861 RchiOBHm_Chr6g0252871 RchiOBHm_Chr6g0253841 RchiOBHm_Chr6g0253921 RchiOBHm_Chr6g0253941
rosa_laevigata RLG00000007595 RLG00000014953 RLG00000014955 RLG00000014957 RLG00000014958 RLG00000015058 RLG00000017917 RLG00000022703
rosa_multiflora Rmu_sc0000829.1_g000012 Rmu_sc0000829.1_g000015 Rmu_sc0000829.1_g000016 Rmu_sc0000927.1_g000006 Rmu_sc0001716.1_g000004 Rmu_sc0003921.1_g000007
rosa_roxburghii Rroxscaffold_4G00307570 Rroxscaffold_6G00391470 Rroxscaffold_6G00426970 Rroxscaffold_7G00211390 Rroxscaffold_7G00211420 Rroxscaffold_7G00211430 Rroxscaffold_7G00212350 Rroxscaffold_7G00212370
rosa_rugosa Rorug02G0175400 Rorug02G0615300 Rorug03G0262600 Rorug03G0262700 Rorug05G0539200 Rorug05G0539400 Rorug05G0548300 Rorug05G0548400 Rorug05G0548500 Rorug05G0548600
rosa_samantha Rh2BG240600 Rh3AG014100 Rh3AG311400 Rh3BG013900 Rh3BG347300 Rh3CG345400 Rh3DG347600 Rh6AG055200 Rh6AG063900 Rh6AG064600 Rh6AG064800 Rh6BG049400 Rh6BG049500 Rh6BG057700 Rh6BG058000 Rh6CG048200 Rh6CG048300 Rh6CG057600 Rh6CG057900 Rh6DG043800 Rh6DG043900
rosa_wichuraiana Rw2G017640 Rw6G005000 Rw6G005670 Rw6G005710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 489, 986
AatII GACGTC 1 cut(s) 70
AciI CCGC 1 cut(s) 21
AcoI YGGCCR 2 cut(s) 99, 1015
AcsI RAATTY 3 cut(s) 233, 761, 822
AcuI CTGAAG 1 cut(s) 243
AcyI GRCGYC 1 cut(s) 67
AfaI GTAC 2 cut(s) 722, 943
AfiI CCNNNNNNNGG 2 cut(s) 321, 638
AgsI TTSAA 5 cut(s) 660, 700, 738, 776, 857
AjiI CACGTC 1 cut(s) 576
AjnI CCWGG 3 cut(s) 53, 473, 991
AluBI AGCT 5 cut(s) 89, 290, 425, 732, 1021
AluI AGCT 5 cut(s) 89, 290, 425, 732, 1021
Alw26I GTCTC 3 cut(s) 58, 290, 658
Ama87I CYCGRG 1 cut(s) 245
AoxI GGCC 3 cut(s) 99, 476, 1015
ApeKI GCWGC 6 cut(s) 48, 89, 287, 438, 642, 729
ApoI RAATTY 3 cut(s) 233, 761, 822
AspS9I GGNCC 3 cut(s) 41, 258, 477
AsuHPI GGTGA 5 cut(s) 239, 328, 609, 850, 1007
AvaI CYCGRG 1 cut(s) 245
AvaII GGWCC 2 cut(s) 41, 258
BalI TGGCCA 2 cut(s) 101, 1017
BarI GAAGNNNNNNTAC 2 cut(s) 656, 688
BbsI GAAGAC 1 cut(s) 391
BbvI GCAGC 6 cut(s) 60, 76, 299, 450, 629, 741
BccI CCATC 5 cut(s) 26, 341, 782, 938, 1021
BciT130I CCWGG 3 cut(s) 55, 475, 993
BcoDI GTCTC 3 cut(s) 58, 290, 658
BfaI CTAG 3 cut(s) 518, 827, 861
BfmI CTRYAG 2 cut(s) 128, 436
BisI GCNGC 6 cut(s) 49, 90, 288, 439, 643, 730
BlsI GCNGC 6 cut(s) 50, 91, 289, 440, 644, 731
BmcAI AGTACT 1 cut(s) 943
Bme1390I CCNGG 3 cut(s) 55, 475, 993
Bme18I GGWCC 2 cut(s) 41, 258
BmeT110I CYCGRG 1 cut(s) 245
BmgBI CACGTC 1 cut(s) 576
BmgT120I GGNCC 3 cut(s) 41, 258, 477
BmrFI CCNGG 3 cut(s) 55, 475, 993
BmsI GCATC 1 cut(s) 273
BpiI GAAGAC 1 cut(s) 391
BpuEI CTTGAG 2 cut(s) 276, 1007
BsaBI GATNNNNATC 1 cut(s) 1031
BsaHI GRCGYC 1 cut(s) 67
BsaJI CCNNGG 6 cut(s) 53, 254, 282, 315, 903, 991
Bsc4I CCNNNNNNNGG 2 cut(s) 321, 638
Bse1I ACTGG 1 cut(s) 403
Bse8I GATNNNNATC 1 cut(s) 1031
BseBI CCWGG 3 cut(s) 55, 475, 993
BseDI CCNNGG 6 cut(s) 53, 254, 282, 315, 903, 991
BseGI GGATG 2 cut(s) 576, 914
BseJI GATNNNNATC 1 cut(s) 1031
BseLI CCNNNNNNNGG 2 cut(s) 321, 638
BseMII CTCAG 1 cut(s) 931
BseNI ACTGG 1 cut(s) 403
BseRI GAGGAG 5 cut(s) 129, 132, 135, 179, 421
BseXI GCAGC 6 cut(s) 60, 76, 299, 450, 629, 741
BshFI GGCC 3 cut(s) 101, 478, 1017
BsiHKCI CYCGRG 1 cut(s) 245
BslFI GGGAC 2 cut(s) 351, 377
BslI CCNNNNNNNGG 2 cut(s) 321, 638
BsmAI GTCTC 3 cut(s) 58, 290, 658
BsmBI CGTCTC 1 cut(s) 58
BsmFI GGGAC 2 cut(s) 351, 377
BsmI GAATGC 1 cut(s) 613
BsnI GGCC 3 cut(s) 101, 478, 1017
BsoBI CYCGRG 1 cut(s) 245
Bsp1407I TGTACA 1 cut(s) 720
Bsp143I GATC 1 cut(s) 886
BspACI CCGC 1 cut(s) 21
BspANI GGCC 3 cut(s) 101, 478, 1017
BspCNI CTCAG 1 cut(s) 930
BspMAI CTGCAG 1 cut(s) 440
BsrGI TGTACA 1 cut(s) 720
BsrI ACTGG 1 cut(s) 403
BssECI CCNNGG 6 cut(s) 53, 254, 282, 315, 903, 991
BssMI GATC 1 cut(s) 886
BssNI GRCGYC 1 cut(s) 67
BssT1I CCWWGG 1 cut(s) 903
Bst2UI CCWGG 3 cut(s) 55, 475, 993
Bst4CI ACNGT 4 cut(s) 97, 391, 927, 941
Bst6I CTCTTC 3 cut(s) 56, 156, 661
BstACI GRCGYC 1 cut(s) 67
BstAUI TGTACA 1 cut(s) 720
BstC8I GCNNGC 2 cut(s) 427, 1019
BstDEI CTNAG 2 cut(s) 845, 917
BstDSI CCRYGG 1 cut(s) 315
BstENI CCTNNNNNAGG 1 cut(s) 636
BstF5I GGATG 2 cut(s) 576, 914
BstKTI GATC 1 cut(s) 889
BstMAI GTCTC 3 cut(s) 58, 290, 658
BstMBI GATC 1 cut(s) 886
BstMWI GCNNNNNNNGC 3 cut(s) 98, 287, 435
BstNI CCWGG 3 cut(s) 55, 475, 993
BstNSI RCATGY 1 cut(s) 609
BstSCI CCNGG 3 cut(s) 53, 473, 991
BstSFI CTRYAG 2 cut(s) 128, 436
BstV1I GCAGC 6 cut(s) 60, 76, 299, 450, 629, 741
BstV2I GAAGAC 1 cut(s) 391
BsuRI GGCC 3 cut(s) 101, 478, 1017
BtgI CCRYGG 1 cut(s) 315
BtrI CACGTC 1 cut(s) 576
BtsCI GGATG 2 cut(s) 576, 914
BtsIMutI CAGTG 1 cut(s) 410
Cac8I GCNNGC 2 cut(s) 427, 1019
Cfr13I GGNCC 3 cut(s) 41, 258, 477
Csp6I GTAC 2 cut(s) 721, 942
CviAII CATG 5 cut(s) 468, 537, 596, 606, 627
CviQI GTAC 2 cut(s) 721, 942
DdeI CTNAG 2 cut(s) 845, 917
DpnI GATC 1 cut(s) 888
DpnII GATC 1 cut(s) 886
EaeI YGGCCR 2 cut(s) 99, 1015
Eam1104I CTCTTC 3 cut(s) 56, 156, 661
EarI CTCTTC 3 cut(s) 56, 156, 661
EciI GGCGGA 1 cut(s) 36
Eco130I CCWWGG 1 cut(s) 903
Eco32I GATATC 1 cut(s) 1033
Eco47I GGWCC 2 cut(s) 41, 258
Eco57I CTGAAG 1 cut(s) 243
Eco88I CYCGRG 1 cut(s) 245
EcoNI CCTNNNNNAGG 1 cut(s) 636
EcoRI GAATTC 1 cut(s) 233
EcoRII CCWGG 3 cut(s) 53, 473, 991
EcoRV GATATC 1 cut(s) 1033
EcoT14I CCWWGG 1 cut(s) 903
EcoT22I ATGCAT 1 cut(s) 615
ErhI CCWWGG 1 cut(s) 903
Esp3I CGTCTC 1 cut(s) 58
FaeI CATG 5 cut(s) 471, 540, 599, 609, 630
FaqI GGGAC 2 cut(s) 351, 377
FatI CATG 5 cut(s) 467, 536, 595, 605, 626
FauNDI CATATG 1 cut(s) 1040
Fnu4HI GCNGC 6 cut(s) 49, 90, 288, 439, 643, 730
FokI GGATG 2 cut(s) 583, 921
Fsp4HI GCNGC 6 cut(s) 49, 90, 288, 439, 643, 730
FspBI CTAG 3 cut(s) 518, 827, 861
GluI GCNGC 6 cut(s) 49, 90, 288, 439, 643, 730
HaeIII GGCC 3 cut(s) 101, 478, 1017
Hin1I GRCGYC 1 cut(s) 67
Hin1II CATG 5 cut(s) 471, 540, 599, 609, 630
HinfI GANTC 6 cut(s) 9, 146, 200, 248, 380, 521
HphI GGTGA 5 cut(s) 239, 328, 609, 850, 1007
Hpy166II GTNNAC 1 cut(s) 914
Hpy188I TCNGA 4 cut(s) 84, 157, 205, 920
Hpy188III TCNNGA 4 cut(s) 293, 518, 776, 1024
Hpy8I GTNNAC 1 cut(s) 914
Hpy99I CGWCG 1 cut(s) 72
HpyAV CCTTC 4 cut(s) 32, 218, 474, 1078
HpyCH4III ACNGT 4 cut(s) 97, 391, 927, 941
HpyCH4IV ACGT 2 cut(s) 67, 575
HpyCH4V TGCA 7 cut(s) 438, 561, 579, 613, 645, 707, 1038
HpyF10VI GCNNNNNNNGC 3 cut(s) 98, 287, 435
HpyF3I CTNAG 2 cut(s) 845, 917
HpySE526I ACGT 2 cut(s) 67, 575
Hsp92I GRCGYC 1 cut(s) 67
Hsp92II CATG 5 cut(s) 471, 540, 599, 609, 630
Kzo9I GATC 1 cut(s) 886
LmnI GCTCC 2 cut(s) 434, 983
Lsp1109I GCAGC 6 cut(s) 60, 76, 299, 450, 629, 741
LweI GCATC 1 cut(s) 273
MaeI CTAG 3 cut(s) 518, 827, 861
MaeII ACGT 2 cut(s) 67, 575
MaeIII GTNAC 2 cut(s) 238, 1084
MalI GATC 1 cut(s) 888
MboI GATC 1 cut(s) 886
MlsI TGGCCA 2 cut(s) 101, 1017
MluCI AATT 6 cut(s) 233, 269, 525, 738, 761, 822
MluNI TGGCCA 2 cut(s) 101, 1017
MlyI GAGTC 1 cut(s) 257
Mox20I TGGCCA 2 cut(s) 101, 1017
Mph1103I ATGCAT 1 cut(s) 615
MscI TGGCCA 2 cut(s) 101, 1017
MseI TTAA 3 cut(s) 450, 753, 1090
Msp20I TGGCCA 2 cut(s) 101, 1017
MspA1I CMGCKG 1 cut(s) 89
MspR9I CCNGG 3 cut(s) 55, 475, 993
Mva1269I GAATGC 1 cut(s) 613
MvaI CCWGG 3 cut(s) 55, 475, 993
MwoI GCNNNNNNNGC 3 cut(s) 98, 287, 435
NdeI CATATG 1 cut(s) 1040
NdeII GATC 1 cut(s) 886
NlaIII CATG 5 cut(s) 471, 540, 599, 609, 630
NmeAIII GCCGAG 2 cut(s) 263, 279
NsiI ATGCAT 1 cut(s) 615
NspI RCATGY 1 cut(s) 609
PaeR7I CTCGAG 1 cut(s) 245
PcsI WCGNNNNNNNCGW 2 cut(s) 11, 243
PctI GAATGC 1 cut(s) 613
PfeI GAWTC 5 cut(s) 9, 146, 200, 380, 521
PflFI GACNNNGTC 1 cut(s) 69
PkrI GCNGC 6 cut(s) 50, 91, 289, 440, 644, 731
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
PsiI TTATAA 2 cut(s) 489, 986
Psp6I CCWGG 3 cut(s) 53, 473, 991
PspGI CCWGG 3 cut(s) 53, 473, 991
PspPI GGNCC 3 cut(s) 41, 258, 477
PspXI VCTCGAGB 1 cut(s) 245
PstI CTGCAG 1 cut(s) 440
PsyI GACNNNGTC 1 cut(s) 69
PvuII CAGCTG 1 cut(s) 89
RsaI GTAC 2 cut(s) 722, 943
RsaNI GTAC 2 cut(s) 721, 942
SaqAI TTAA 3 cut(s) 450, 753, 1090
SatI GCNGC 6 cut(s) 49, 90, 288, 439, 643, 730
Sau3AI GATC 1 cut(s) 886
Sau96I GGNCC 3 cut(s) 41, 258, 477
ScaI AGTACT 1 cut(s) 943
SchI GAGTC 1 cut(s) 257
ScrFI CCNGG 3 cut(s) 55, 475, 993
SfaNI GCATC 1 cut(s) 273
SfcI CTRYAG 2 cut(s) 128, 436
Sfr274I CTCGAG 1 cut(s) 245
SinI GGWCC 2 cut(s) 41, 258
SlaI CTCGAG 1 cut(s) 245
SmlI CTYRAG 3 cut(s) 245, 291, 1022
SmoI CTYRAG 3 cut(s) 245, 291, 1022
Sse9I AATT 6 cut(s) 233, 269, 525, 738, 761, 822
SsiI CCGC 1 cut(s) 21
SspMI CTAG 3 cut(s) 518, 827, 861
StyD4I CCNGG 3 cut(s) 53, 473, 991
StyI CCWWGG 1 cut(s) 903
TaaI ACNGT 4 cut(s) 97, 391, 927, 941
TaiI ACGT 2 cut(s) 70, 578
TaqI TCGA 2 cut(s) 246, 267
TaqII GACCGA 2 cut(s) 58, 359
TasI AATT 6 cut(s) 233, 269, 525, 738, 761, 822
TatI WGTACW 2 cut(s) 720, 941
TfiI GAWTC 5 cut(s) 9, 146, 200, 380, 521
Tru1I TTAA 3 cut(s) 450, 753, 1090
Tru9I TTAA 3 cut(s) 450, 753, 1090
TscAI CASTG 1 cut(s) 410
TseI GCWGC 6 cut(s) 48, 89, 287, 438, 642, 729
TspDTI ATGAA 7 cut(s) 42, 246, 456, 606, 612, 615, 960
TspGWI ACGGA 3 cut(s) 332, 583, 1053
TspRI CASTG 1 cut(s) 410
Tth111I GACNNNGTC 1 cut(s) 69
VpaK11BI GGWCC 2 cut(s) 41, 258
XagI CCTNNNNNAGG 1 cut(s) 636
XapI RAATTY 3 cut(s) 233, 761, 822
XbaI TCTAGA 1 cut(s) 517
XceI RCATGY 1 cut(s) 609
XcmI CCANNNNNNNNNTGG 2 cut(s) 268, 410
XhoI CTCGAG 1 cut(s) 245
XspI CTAG 3 cut(s) 518, 827, 861
ZraI GACGTC 1 cut(s) 68
ZrmI AGTACT 1 cut(s) 943
Zsp2I ATGCAT 1 cut(s) 615
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.