Rmu_sc0003133.1_g000026

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003133.1
Physical Location & Seq
Reverse (-)
137285 .. 137611
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003133.1_g000026.1.cds

Sequence Viewer

Length: 327 bp
atgttggcaatccgtaaagggcttgacctattacattcccttcaagaacataatgtggttgttcaaagtgacttatcagaagctattgcagaaattcaagtggaagatcacaatttgctggctaatggtggtttcattgatgatatcaaacagatttggcagaaactcaaggggattcaattagttcatacacctagaaattgcaatcaagttgcgcaccgacttgctgcaataaattttgaagcaactcatgcttctgtatggctgcatcatgcacctaatcgtatgcttgatgttctcaactatgattgtaacaagctcaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.25

Weight (kDa)

6.2

Isoelectric Point (pI)

26.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000519)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g27751 FvH4_2g10620 FvH4_4g13701 FvH4_4g17370 FvH4_6g49051
pyrus_communis pycom11g18020
rosa_chinensis RchiOBHm_Chr1g0331041 RchiOBHm_Chr2g0088901 RchiOBHm_Chr2g0100641 RchiOBHm_Chr6g0281891
rosa_laevigata RLG00000011791 RLG00000028155 RLG00000035981
rosa_multiflora Rmu_co8368635.1_g000001 Rmu_co8370105.1_g000001 Rmu_sc0000850.1_g000010 Rmu_sc0001374.1_g000060 Rmu_sc0001654.1_g000024 Rmu_sc0001840.1_g000023 Rmu_sc0001900.1_g000032 Rmu_sc0002687.1_g000008 Rmu_sc0003133.1_g000026 Rmu_sc0003252.1_g000002 Rmu_sc0004206.1_g000011 Rmu_sc0004666.1_g000002 Rmu_sc0006255.1_g000004 Rmu_sc0006812.1_g000001 Rmu_sc0007025.1_g000012 Rmu_sc0007767.1_g000020 Rmu_sc0007833.1_g000004 Rmu_sc0007848.1_g000020 Rmu_sc0007883.1_g000010 Rmu_sc0008270.1_g000003 Rmu_sc0012097.1_g000011 Rmu_sc0014445.1_g000002 Rmu_sc0023292.1_g000001
rosa_roxburghii Rroxscaffold_1G00021670 Rroxscaffold_1G00027660 Rroxscaffold_1G00056090 Rroxscaffold_2G00111250 Rroxscaffold_2G00111320 Rroxscaffold_3G00248390 Rroxscaffold_6G00394880 Rroxscaffold_7G00192450
rosa_rugosa Rorug01G0071500 Rorug01G0183900 Rorug01G0242400 Rorug02G0045300 Rorug02G0051000 Rorug02G0061700 Rorug02G0091500 Rorug02G0091600 Rorug02G0091700 Rorug02G0091800 Rorug02G0284700 Rorug02G0335100 Rorug02G0336900 Rorug02G0405500.1 Rorug02G0498300 Rorug03G0173700 Rorug03G0228900 Rorug03G0256300 Rorug04G0014300 Rorug04G0130400 Rorug04G0138100 Rorug04G0138100 Rorug04G0150400.1 Rorug05G0000600 Rorug05G0160400 Rorug05G0165600 Rorug05G0378500 Rorug06G0072000 Rorug06G0107900 Rorug06G0268700 Rorug07G0015500 Rorug07G0266300 Rorug07G0274500
rosa_samantha Rh2AG439400 Rh2AG561100 Rh2DG459400 Rh3AG236100 Rh4BG212500 Rh6AG046300 Rh6BG073000 Rh7DG249100
rosa_wichuraiana Rw2G010910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 216
AcsI RAATTY 2 cut(s) 93, 235
AgsI TTSAA 5 cut(s) 44, 65, 98, 179, 242
AluBI AGCT 2 cut(s) 83, 319
AluI AGCT 2 cut(s) 83, 319
ApeKI GCWGC 2 cut(s) 227, 265
ApoI RAATTY 2 cut(s) 93, 235
AspLEI GCGC 1 cut(s) 217
BbvI GCAGC 2 cut(s) 214, 252
BfaI CTAG 1 cut(s) 195
BisI GCNGC 2 cut(s) 228, 266
BlsI GCNGC 2 cut(s) 229, 267
BmsI GCATC 1 cut(s) 277
BpuEI CTTGAG 1 cut(s) 152
BseXI GCAGC 2 cut(s) 214, 252
Bsp143I GATC 1 cut(s) 106
BssMI GATC 1 cut(s) 106
BstAPI GCANNNNNTGC 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 120
BstHHI GCGC 1 cut(s) 217
BstKTI GATC 1 cut(s) 109
BstMBI GATC 1 cut(s) 106
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstV1I GCAGC 2 cut(s) 214, 252
Cac8I GCNNGC 1 cut(s) 120
CfoI GCGC 1 cut(s) 217
CviAII CATG 2 cut(s) 251, 272
CviJI RGCY 5 cut(s) 22, 83, 122, 265, 319
CviKI_1 RGCY 5 cut(s) 22, 83, 122, 265, 319
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eco32I GATATC 1 cut(s) 145
EcoRV GATATC 1 cut(s) 145
FaeI CATG 2 cut(s) 254, 275
FaiI YATR 7 cut(s) 51, 189, 252, 262, 273, 287, 306
FatI CATG 2 cut(s) 250, 271
Fnu4HI GCNGC 2 cut(s) 228, 266
Fsp4HI GCNGC 2 cut(s) 228, 266
FspBI CTAG 1 cut(s) 195
FspI TGCGCA 1 cut(s) 216
GlaI GCGC 1 cut(s) 216
GluI GCNGC 2 cut(s) 228, 266
HhaI GCGC 1 cut(s) 217
Hin1II CATG 2 cut(s) 254, 275
Hin6I GCGC 1 cut(s) 215
HinP1I GCGC 1 cut(s) 215
HinfI GANTC 1 cut(s) 175
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 50
HpyCH4V TGCA 5 cut(s) 89, 204, 230, 268, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
Hsp92II CATG 2 cut(s) 254, 275
HspAI GCGC 1 cut(s) 215
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 1 cut(s) 104
Lsp1109I GCAGC 2 cut(s) 214, 252
LweI GCATC 1 cut(s) 277
MaeI CTAG 1 cut(s) 195
MaeIII GTNAC 2 cut(s) 68, 311
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 116
MfeI CAATTG 1 cut(s) 322
MluCI AATT 6 cut(s) 93, 112, 179, 199, 235, 322
MunI CAATTG 1 cut(s) 322
MwoI GCNNNNNNNGC 1 cut(s) 251
NdeII GATC 1 cut(s) 106
NlaIII CATG 2 cut(s) 254, 275
NmuCI GTSAC 1 cut(s) 68
NsbI TGCGCA 1 cut(s) 216
PfeI GAWTC 1 cut(s) 175
PkrI GCNGC 2 cut(s) 229, 267
SatI GCNGC 2 cut(s) 228, 266
Sau3AI GATC 1 cut(s) 106
SetI ASST 5 cut(s) 30, 85, 196, 280, 321
SfaNI GCATC 1 cut(s) 277
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
Sse9I AATT 6 cut(s) 93, 112, 179, 199, 235, 322
SspMI CTAG 1 cut(s) 195
TasI AATT 6 cut(s) 93, 112, 179, 199, 235, 322
TfiI GAWTC 1 cut(s) 175
TseFI GTSAC 1 cut(s) 68
TseI GCWGC 2 cut(s) 227, 265
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 124, 176
XapI RAATTY 2 cut(s) 93, 235
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.