Rmu_co8219302.1_g000001

ABC transporter F family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8219302.1
Physical Location & Seq
Forward (+)
1 .. 296
296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8219302.1_g000001.1.cds

Sequence Viewer

Length: 296 bp
tgcaaaaggcgttggagagtgctgtggaggatatggacttgatggggaggcttttggatgagcttgataagcttcagaatcgggcgcaggaatgtgacttgggtatggtggatgcaaagattagtaagttgatgccggatcttgggtttgcgccccaggatggggacaggttgatggcttcgtttagtagtggttggcagatgaggttgtcacttggcaagattttgcttcaggtatatgttttagatgaaaaatgtagttgttggaatgcgagttatagcttgaggtttgcttga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.92

Weight (kDa)

4.65

Isoelectric Point (pI)

44.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000380)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G09930
fragaria_vesca FvH4_1g22620
malus_domestica MD01G1020400.v1.1 MD01G1020500.v1.1 MD15G1331800.v1.1
prunus_persica Prupe.6G171800_v2.0.a1 Prupe.6G171800_v2.0.a1
pyrus_communis pycom15g29330
rosa_chinensis RchiOBHm_Chr1g0349811 RchiOBHm_Chr2g0116631 RchiOBHm_Chr2g0116661 RchiOBHm_Chr2g0116701 RchiOBHm_Chr2g0116721 RchiOBHm_Chr2g0116821 RchiOBHm_Chr2g0116831 RchiOBHm_Chr2g0137191 RchiOBHm_Chr4g0436571 RchiOBHm_Chr5g0033691 RchiOBHm_Chr5g0080211 RchiOBHm_Chr7g0224491
rosa_laevigata RLG00000001144 RLG00000001242 RLG00000008715 RLG00000011571 RLG00000013376 RLG00000018295 RLG00000018297 RLG00000018299 RLG00000018304 RLG00000018340 RLG00000019297
rosa_multiflora Rmu_co8219302.1_g000001 Rmu_co8228065.1_g000001 Rmu_co8391111.1_g000001 Rmu_sc0001896.1_g000033 Rmu_sc0003126.1_g000001 Rmu_sc0004191.1_g000001 Rmu_sc0004942.1_g000016 Rmu_sc0005450.1_g000015 Rmu_sc0010198.1_g000002 Rmu_sc0011574.1_g000003 Rmu_sc0020362.1_g000001 Rmu_sc0020362.1_g000002 Rmu_sc0026531.1_g000001
rosa_roxburghii Rroxscaffold_1G00010030 Rroxscaffold_1G00018300 Rroxscaffold_1G00021420 Rroxscaffold_2G00089320 Rroxscaffold_2G00126980 Rroxscaffold_2G00127000 Rroxscaffold_2G00144860 Rroxscaffold_6G00390340 Rroxscaffold_6G00390350 Rroxscaffold_6G00394730 Rroxscaffold_6G00423750
rosa_rugosa Rorug01G0049700 Rorug01G0284700 Rorug02G0208300 Rorug02G0208400 Rorug02G0208500 Rorug02G0208600 Rorug06G0216100 Rorug06G0216200 Rorug06G0216300
rosa_samantha Rh1AG026000 Rh1AG205600 Rh1AG270100 Rh1CG024200 Rh1DG146900 Rh1DG206100 Rh2AG263300 Rh2AG263500 Rh2AG263700 Rh2AG264100 Rh2AG264200 Rh2AG264800 Rh2BG275100 Rh2BG275200 Rh2BG275300 Rh2BG275500 Rh2BG278500 Rh2CG297300 Rh2CG302200 Rh2DG271500 Rh2DG271600 Rh2DG272100 Rh2DG290100 Rh2DG290200 Rh2DG290700 Rh3AG071300 Rh3CG072500 Rh5AG478400 Rh6AG079600 Rh6AG220800 Rh6BG131400 Rh6DG116900 Rh6DG391500 Rh7AG379600 Rh7CG399100 Rh7CG429600
rosa_wichuraiana Rw2G020730 Rw2G020760 Rw2G051970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 146
AcuI CTGAAG 2 cut(s) 58, 214
AfiI CCNNNNNNNGG 4 cut(s) 142, 160, 161, 162
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 3 cut(s) 63, 72, 281
AluI AGCT 3 cut(s) 63, 72, 281
AlwI GGATC 1 cut(s) 146
AspLEI GCGC 2 cut(s) 87, 153
BccI CCATC 3 cut(s) 36, 154, 168
BciT130I CCWGG 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 157
BmrFI CCNGG 1 cut(s) 157
BmsI GCATC 2 cut(s) 102, 122
BsaJI CCNNGG 1 cut(s) 155
Bsc4I CCNNNNNNNGG 4 cut(s) 142, 160, 161, 162
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 155
BseGI GGATG 3 cut(s) 63, 117, 165
BseLI CCNNNNNNNGG 4 cut(s) 142, 160, 161, 162
BsiSI CCGG 1 cut(s) 136
BslFI GGGAC 1 cut(s) 178
BslI CCNNNNNNNGG 4 cut(s) 142, 160, 161, 162
BsmFI GGGAC 1 cut(s) 178
BsmI GAATGC 1 cut(s) 273
Bsp143I GATC 1 cut(s) 138
BspPI GGATC 1 cut(s) 146
BssECI CCNNGG 1 cut(s) 155
BssMI GATC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 157
BstF5I GGATG 3 cut(s) 63, 117, 165
BstHHI GCGC 2 cut(s) 87, 153
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstNI CCWGG 1 cut(s) 157
BstSCI CCNGG 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 138
BstYI RGATCY 1 cut(s) 138
BtsCI GGATG 3 cut(s) 63, 117, 165
CfoI GCGC 2 cut(s) 87, 153
CviJI RGCY 5 cut(s) 51, 63, 72, 178, 281
CviKI_1 RGCY 5 cut(s) 51, 63, 72, 178, 281
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
Eco57I CTGAAG 2 cut(s) 58, 214
EcoRII CCWGG 1 cut(s) 155
FaiI YATR 5 cut(s) 34, 106, 237, 239, 278
FaqI GGGAC 1 cut(s) 178
FokI GGATG 3 cut(s) 70, 124, 172
GlaI GCGC 2 cut(s) 86, 152
HapII CCGG 1 cut(s) 136
HhaI GCGC 2 cut(s) 87, 153
Hin6I GCGC 2 cut(s) 85, 151
HinP1I GCGC 2 cut(s) 85, 151
HindIII AAGCTT 1 cut(s) 70
HinfI GANTC 1 cut(s) 78
HpaII CCGG 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 77
HpyCH4V TGCA 2 cut(s) 3, 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
HspAI GCGC 2 cut(s) 85, 151
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 6 cut(s) 73, 142, 149, 153, 169, 217
LweI GCATC 2 cut(s) 102, 122
MaeIII GTNAC 2 cut(s) 94, 209
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MflI RGATCY 1 cut(s) 138
MmeI TCCRAC 1 cut(s) 244
MnlI CCTC 4 cut(s) 21, 41, 197, 278
MspI CCGG 1 cut(s) 136
MspR9I CCNGG 1 cut(s) 157
Mva1269I GAATGC 1 cut(s) 273
MvaI CCWGG 1 cut(s) 157
MwoI GCNNNNNNNGC 1 cut(s) 69
NdeII GATC 1 cut(s) 138
NmuCI GTSAC 2 cut(s) 94, 209
PctI GAATGC 1 cut(s) 273
PfeI GAWTC 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PsuI RGATCY 1 cut(s) 138
Sau3AI GATC 1 cut(s) 138
ScrFI CCNGG 1 cut(s) 157
SetI ASST 7 cut(s) 65, 74, 172, 208, 236, 283, 289
SfaNI GCATC 2 cut(s) 102, 122
SmlI CTYRAG 1 cut(s) 282
SmoI CTYRAG 1 cut(s) 282
StyD4I CCNGG 1 cut(s) 155
TfiI GAWTC 1 cut(s) 78
TseFI GTSAC 2 cut(s) 94, 209
Tsp45I GTSAC 2 cut(s) 94, 209
TspDTI ATGAA 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.