Rmu_sc0001347.1_g000002

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001347.1
OG0000560
Physical Location & Seq
Reverse (-)
1920 .. 3218
1299 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001347.1_g000002.1.cds

Sequence Viewer

Length: 1158 bp
atgacgaaaacacaattgcaaagacagcaaaggcaagtagccgaggctaagaaagcccgcctgagcgagacaaccagaacttcacctccgcgacccgttaaaaggtctggatacgaaacggcaccgagaaggtttagaacatacgtgaaaatgagcactggtcctcctgtggataaatcaactcgggatactgaagacatgcaaatcgactcaagcaggaagggggtattgaaggttcactttaaagaggcccctcacccaaaaccgttggttgtagtggataggaatcgagatccgccctttacggcagaaggactcataactatgcgaaattatcatcttttgcattcggccattgattggtatggtttgactaaggaggaaagcaagcttttaaatgaggtgcgtaaggatcgcaacagatgcgaagaacattgggcacctaatgtgagaagaggagtgagagccaaatatcaagcttgtttgcaagatcaggaaataaaggctgattataattctcttcccatttcaaaaggcgacctacagtatttgagggaatactttagtatccactcggccgaagaattattcggcctaacgattgaggaacagagacttgcgttcatatttgaggaacgcatggagaagatggatagagaaagaggggaaattcttcacgccctgagttcacccaagtcttcatcagatacaccgacatcgggtgaggaggaagaagaaatttttgagtcaaatggcaatgaagagcctttcgtaaaactgtacaaggacctgaacccgcccttttcagttaagggacttaagagaatgaaggagtatcatcgaaagaattctgctcttgcattgtacggaccaacaaataaggagatggacacattacatatgatcgctgaatgcccaaagtcagcaacccttttgctggacttggattctagccttggtttaaaggaaagagagctgatgaaacatttcgaccaccatgtccgcgaagaagaaaatcgtcaacaagctcaagcaaaccaagatttggccaaatggttagaagacactgacacaaatgataaacaagaccagtatttagatgacttagatcctgaagtcaatggccaaggtgatcaaggcctatgggaggacgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 rve

Protein Analysis

385

Amino Acids

44.73

Weight (kDa)

5.76

Isoelectric Point (pI)

51.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000560)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21400 FvH4_1g29793 FvH4_2g35581 FvH4_4g18554 FvH4_6g21671
pyrus_communis pycom11g14070
rosa_chinensis RchiOBHm_Chr6g0263201
rosa_laevigata RLG00000001861 RLG00000002050 RLG00000018783 RLG00000022649 RLG00000030152
rosa_multiflora Rmu_co8107100.1_g000001 Rmu_sc0000805.1_g000009 Rmu_sc0001347.1_g000002 Rmu_sc0001896.1_g000004 Rmu_sc0002170.1_g000040 Rmu_sc0002413.1_g000005 Rmu_sc0002489.1_g000053 Rmu_sc0002942.1_g000015 Rmu_sc0003071.1_g000022 Rmu_sc0003623.1_g000021 Rmu_sc0004063.1_g000005 Rmu_sc0004574.1_g000014 Rmu_sc0004723.1_g000009 Rmu_sc0005177.1_g000013 Rmu_sc0005994.1_g000011 Rmu_sc0006163.1_g000006 Rmu_sc0006583.1_g000008 Rmu_sc0008303.1_g000005 Rmu_sc0009027.1_g000002 Rmu_sc0009027.1_g000003 Rmu_sc0011790.1_g000009 Rmu_sc0011833.1_g000005 Rmu_sc0013493.1_g000006 Rmu_sc0016701.1_g000002 Rmu_sc0022033.1_g000001 Rmu_sc0022185.1_g000001 Rmu_sc0027245.1_g000005 Rmu_sc0030292.1_g000002 Rmu_ssc0000242.1_g000003
rosa_roxburghii Rroxscaffold_1G00015200 Rroxscaffold_1G00059290 Rroxscaffold_2G00079850 Rroxscaffold_2G00079860 Rroxscaffold_2G00107520 Rroxscaffold_2G00123420 Rroxscaffold_2G00123430 Rroxscaffold_3G00265790 Rroxscaffold_5G00335960 Rroxscaffold_5G00338270 Rroxscaffold_5G00343980 Rroxscaffold_5G00343990
rosa_samantha Rh1AG036500 Rh1DG429900 Rh2AG172600 Rh2AG610900 Rh2BG180200 Rh2BG180300 Rh2BG340600 Rh2BG400300 Rh2BG468400 Rh2BG478200 Rh2BG612500 Rh2BG612600 Rh3BG290000 Rh3BG290100 Rh3BG345200 Rh3BG345300 Rh3BG359800 Rh3CG291300 Rh4CG156300 Rh4CG264600 Rh5AG430300 Rh5BG185400 Rh6DG198700 Rh7CG199900 Rh7CG200000 Rh7CG370300 Rh7CG370600 Rh7CG395500 Rh7DG405800 Rh7DG405900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 513
AasI GACNNNNNNGTC 1 cut(s) 998
AccB1I GGYRCC 2 cut(s) 121, 439
AccB7I CCANNNNNTGG 2 cut(s) 360, 1045
AccII CGCG 2 cut(s) 91, 1005
AciI CCGC 5 cut(s) 58, 89, 296, 797, 1003
AclWI GGATC 3 cut(s) 287, 420, 1103
AcoI YGGCCR 4 cut(s) 351, 576, 1047, 1123
AcsI RAATTY 3 cut(s) 669, 738, 847
AcuI CTGAAG 2 cut(s) 213, 1134
AfaI GTAC 2 cut(s) 782, 866
AfiI CCNNNNNNNGG 6 cut(s) 102, 360, 719, 937, 1045, 1147
AflII CTTAAG 1 cut(s) 818
AgsI TTSAA 2 cut(s) 232, 531
AloI GAACNNNNNNTCC 2 cut(s) 70, 102
AluBI AGCT 4 cut(s) 391, 479, 976, 1028
AluI AGCT 4 cut(s) 391, 479, 976, 1028
Alw21I GWGCWC 1 cut(s) 158
Alw26I GTCTC 2 cut(s) 62, 607
AlwI GGATC 3 cut(s) 287, 420, 1103
Ama87I CYCGRG 1 cut(s) 183
AoxI GGCC 7 cut(s) 249, 351, 576, 592, 1047, 1123, 1138
ApoI RAATTY 3 cut(s) 669, 738, 847
Asp700I GAANNNNTTC 3 cut(s) 672, 847, 986
AspS9I GGNCC 4 cut(s) 161, 250, 787, 869
AsuHPI GGTGA 5 cut(s) 75, 248, 681, 734, 1142
AvaI CYCGRG 1 cut(s) 183
AvaII GGWCC 3 cut(s) 161, 787, 869
BaeGI GKGCMC 1 cut(s) 442
BaeI ACNNNNGTAYC 2 cut(s) 550, 583
BalI TGGCCA 2 cut(s) 1049, 1125
BanI GGYRCC 2 cut(s) 121, 439
BbsI GAAGAC 3 cut(s) 201, 690, 1068
Bbv12I GWGCWC 1 cut(s) 158
BccI CCATC 2 cut(s) 643, 880
BceAI ACGGC 2 cut(s) 135, 321
BciVI GTATCC 3 cut(s) 104, 181, 578
BclI TGATCA 1 cut(s) 1132
BcoDI GTCTC 2 cut(s) 62, 607
BfaI CTAG 1 cut(s) 951
BfmI CTRYAG 1 cut(s) 542
BfrI CTTAAG 1 cut(s) 818
BfuI GTATCC 3 cut(s) 104, 181, 578
Bme18I GGWCC 3 cut(s) 161, 787, 869
BmeT110I CYCGRG 1 cut(s) 183
BmgT120I GGNCC 4 cut(s) 161, 250, 787, 869
BmiI GGNNCC 3 cut(s) 123, 252, 441
BmsI GCATC 1 cut(s) 413
BpiI GAAGAC 3 cut(s) 201, 690, 1068
Bpu10I CCTNAGC 1 cut(s) 62
BpuEI CTTGAG 2 cut(s) 196, 1014
BsaAI YACGTR 1 cut(s) 145
BsaBI GATNNNNATC 1 cut(s) 285
BsaJI CCNNGG 3 cut(s) 42, 955, 1126
BsaXI ACNNNNNCTCC 4 cut(s) 70, 100, 148, 178
Bsc4I CCNNNNNNNGG 6 cut(s) 102, 360, 719, 937, 1045, 1147
Bse1I ACTGG 2 cut(s) 163, 1090
Bse3DI GCAATG 1 cut(s) 763
Bse8I GATNNNNATC 1 cut(s) 285
BseDI CCNNGG 3 cut(s) 42, 955, 1126
BseJI GATNNNNATC 1 cut(s) 285
BseLI CCNNNNNNNGG 6 cut(s) 102, 360, 719, 937, 1045, 1147
BseMI GCAATG 1 cut(s) 763
BseMII CTCAG 2 cut(s) 53, 674
BseNI ACTGG 2 cut(s) 163, 1090
BseRI GAGGAG 2 cut(s) 471, 740
BseSI GKGCMC 1 cut(s) 442
BseX3I CGGCCG 1 cut(s) 576
Bsh1236I CGCG 2 cut(s) 91, 1005
Bsh1285I CGRYCG 1 cut(s) 579
BshFI GGCC 7 cut(s) 251, 353, 578, 594, 1049, 1125, 1140
BshNI GGYRCC 2 cut(s) 121, 439
BsiEI CGRYCG 1 cut(s) 579
BsiHKAI GWGCWC 1 cut(s) 158
BsiHKCI CYCGRG 1 cut(s) 183
BslFI GGGAC 1 cut(s) 828
BslI CCNNNNNNNGG 6 cut(s) 102, 360, 719, 937, 1045, 1147
BsmAI GTCTC 2 cut(s) 62, 607
BsmFI GGGAC 1 cut(s) 828
BsmI GAATGC 2 cut(s) 346, 917
BsnI GGCC 7 cut(s) 251, 353, 578, 594, 1049, 1125, 1140
BsoBI CYCGRG 1 cut(s) 183
Bsp1286I GDGCHC 2 cut(s) 158, 442
Bsp1407I TGTACA 1 cut(s) 780
Bsp143I GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
BspACI CCGC 5 cut(s) 58, 89, 296, 797, 1003
BspANI GGCC 7 cut(s) 251, 353, 578, 594, 1049, 1125, 1140
BspCNI CTCAG 2 cut(s) 54, 675
BspFNI CGCG 2 cut(s) 91, 1005
BspLI GGNNCC 3 cut(s) 123, 252, 441
BspPI GGATC 3 cut(s) 287, 420, 1103
BspQI GCTCTTC 1 cut(s) 756
BspT107I GGYRCC 2 cut(s) 121, 439
BspTI CTTAAG 1 cut(s) 818
BsrDI GCAATG 1 cut(s) 763
BsrGI TGTACA 1 cut(s) 780
BsrI ACTGG 2 cut(s) 163, 1090
BssECI CCNNGG 3 cut(s) 42, 955, 1126
BssMI GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
BssT1I CCWWGG 2 cut(s) 955, 1126
Bst4CI ACNGT 3 cut(s) 267, 546, 780
Bst6I CTCTTC 3 cut(s) 448, 525, 756
BstAFI CTTAAG 1 cut(s) 818
BstAPI GCANNNNNTGC 1 cut(s) 423
BstAUI TGTACA 1 cut(s) 780
BstBAI YACGTR 1 cut(s) 145
BstC8I GCNNGC 2 cut(s) 58, 389
BstDEI CTNAG 5 cut(s) 48, 62, 375, 683, 1105
BstENI CCTNNNNNAGG 1 cut(s) 1145
BstFNI CGCG 2 cut(s) 91, 1005
BstKTI GATC 6 cut(s) 295, 415, 493, 906, 1111, 1135
BstMAI GTCTC 2 cut(s) 62, 607
BstMBI GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
BstMCI CGRYCG 1 cut(s) 579
BstMWI GCNNNNNNNGC 3 cut(s) 25, 53, 423
BstNSI RCATGY 1 cut(s) 202
BstSFI CTRYAG 1 cut(s) 542
BstSLI GKGCMC 1 cut(s) 442
BstUI CGCG 2 cut(s) 91, 1005
BstV2I GAAGAC 3 cut(s) 201, 690, 1068
BstX2I RGATCY 2 cut(s) 292, 1108
BstYI RGATCY 2 cut(s) 292, 1108
BstZI CGGCCG 1 cut(s) 576
BsuI GTATCC 3 cut(s) 104, 181, 578
BsuRI GGCC 7 cut(s) 251, 353, 578, 594, 1049, 1125, 1140
BtsIMutI CAGTG 2 cut(s) 156, 1065
Cac8I GCNNGC 2 cut(s) 58, 389
Cfr13I GGNCC 4 cut(s) 161, 250, 787, 869
Csp6I GTAC 2 cut(s) 781, 865
CviAII CATG 3 cut(s) 199, 640, 998
CviQI GTAC 2 cut(s) 781, 865
DdeI CTNAG 5 cut(s) 48, 62, 375, 683, 1105
DpnI GATC 6 cut(s) 294, 414, 492, 905, 1110, 1134
DpnII GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
DraI TTTAAA 3 cut(s) 244, 396, 963
DrdI GACNNNNNNGTC 1 cut(s) 998
DseDI GACNNNNNNGTC 1 cut(s) 998
EaeI YGGCCR 4 cut(s) 351, 576, 1047, 1123
EagI CGGCCG 1 cut(s) 576
Eam1104I CTCTTC 3 cut(s) 448, 525, 756
EarI CTCTTC 3 cut(s) 448, 525, 756
EciI GGCGGA 1 cut(s) 285
EclXI CGGCCG 1 cut(s) 576
Eco130I CCWWGG 2 cut(s) 955, 1126
Eco147I AGGCCT 1 cut(s) 1140
Eco47I GGWCC 3 cut(s) 161, 787, 869
Eco52I CGGCCG 1 cut(s) 576
Eco57I CTGAAG 2 cut(s) 213, 1134
Eco88I CYCGRG 1 cut(s) 183
EcoNI CCTNNNNNAGG 1 cut(s) 1145
EcoO109I RGGNCCY 2 cut(s) 250, 787
EcoRI GAATTC 1 cut(s) 847
EcoT14I CCWWGG 2 cut(s) 955, 1126
ErhI CCWWGG 2 cut(s) 955, 1126
FaeI CATG 3 cut(s) 202, 643, 1001
FalI AAGNNNNNCTT 2 cut(s) 224, 256
FaqI GGGAC 1 cut(s) 828
FatI CATG 3 cut(s) 198, 639, 997
FauI CCCGC 2 cut(s) 65, 804
FauNDI CATATG 1 cut(s) 900
FbaI TGATCA 1 cut(s) 1132
FspBI CTAG 1 cut(s) 951
HaeIII GGCC 7 cut(s) 251, 353, 578, 594, 1049, 1125, 1140
Hin1II CATG 3 cut(s) 202, 643, 1001
HincII GTYRAC 1 cut(s) 1022
HindII GTYRAC 1 cut(s) 1022
HindIII AAGCTT 2 cut(s) 389, 477
HinfI GANTC 5 cut(s) 209, 286, 315, 746, 947
HphI GGTGA 5 cut(s) 75, 248, 681, 734, 1142
Hpy166II GTNNAC 3 cut(s) 238, 689, 1022
Hpy188I TCNGA 1 cut(s) 706
Hpy188III TCNNGA 5 cut(s) 108, 185, 290, 494, 1112
Hpy8I GTNNAC 3 cut(s) 238, 689, 1022
HpyAV CCTTC 5 cut(s) 123, 214, 226, 305, 823
HpyCH4III ACNGT 3 cut(s) 267, 546, 780
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 5 cut(s) 19, 202, 346, 487, 860
HpyF10VI GCNNNNNNNGC 3 cut(s) 25, 53, 423
HpyF3I CTNAG 5 cut(s) 48, 62, 375, 683, 1105
HpySE526I ACGT 1 cut(s) 144
Hsp92II CATG 3 cut(s) 202, 643, 1001
Ksp22I TGATCA 1 cut(s) 1132
Kzo9I GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
LguI GCTCTTC 1 cut(s) 756
LweI GCATC 1 cut(s) 413
MaeI CTAG 1 cut(s) 951
MaeII ACGT 1 cut(s) 144
MalI GATC 6 cut(s) 294, 414, 492, 905, 1110, 1134
MboI GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
MfeI CAATTG 1 cut(s) 14
MflI RGATCY 2 cut(s) 292, 1108
MhlI GDGCHC 2 cut(s) 158, 442
MlsI TGGCCA 2 cut(s) 1049, 1125
MluCI AATT 7 cut(s) 14, 331, 514, 584, 669, 738, 847
MluNI TGGCCA 2 cut(s) 1049, 1125
MlyI GAGTC 3 cut(s) 203, 309, 755
Mox20I TGGCCA 2 cut(s) 1049, 1125
MroXI GAANNNNTTC 3 cut(s) 672, 847, 986
MscI TGGCCA 2 cut(s) 1049, 1125
MseI TTAA 7 cut(s) 99, 243, 395, 810, 819, 962, 1156
MslI CAYNNNNRTG 1 cut(s) 323
Msp20I TGGCCA 2 cut(s) 1049, 1125
MspCI CTTAAG 1 cut(s) 818
MunI CAATTG 1 cut(s) 14
Mva1269I GAATGC 2 cut(s) 346, 917
MvnI CGCG 2 cut(s) 91, 1005
MwoI GCNNNNNNNGC 3 cut(s) 25, 53, 423
NdeI CATATG 1 cut(s) 900
NdeII GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
NlaIII CATG 3 cut(s) 202, 643, 1001
NlaIV GGNNCC 3 cut(s) 123, 252, 441
NmeAIII GCCGAG 2 cut(s) 67, 554
NspI RCATGY 1 cut(s) 202
PceI AGGCCT 1 cut(s) 1140
PciSI GCTCTTC 1 cut(s) 756
PctI GAATGC 2 cut(s) 346, 917
PdmI GAANNNNTTC 3 cut(s) 672, 847, 986
PfeI GAWTC 2 cut(s) 286, 947
PflMI CCANNNNNTGG 2 cut(s) 360, 1045
PleI GAGTC 3 cut(s) 203, 309, 754
PpsI GAGTC 3 cut(s) 203, 309, 754
Ppu21I YACGTR 1 cut(s) 145
PpuMI RGGWCCY 1 cut(s) 787
PsiI TTATAA 1 cut(s) 513
Psp5II RGGWCCY 1 cut(s) 787
PspN4I GGNNCC 3 cut(s) 123, 252, 441
PspPI GGNCC 4 cut(s) 161, 250, 787, 869
PspPPI RGGWCCY 1 cut(s) 787
PsrI GAACNNNNNNTAC 2 cut(s) 219, 251
PsuI RGATCY 2 cut(s) 292, 1108
RsaI GTAC 2 cut(s) 782, 866
RsaNI GTAC 2 cut(s) 781, 865
RseI CAYNNNNRTG 1 cut(s) 323
SapI GCTCTTC 1 cut(s) 756
SaqAI TTAA 7 cut(s) 99, 243, 395, 810, 819, 962, 1156
Sau3AI GATC 6 cut(s) 292, 412, 490, 903, 1108, 1132
Sau96I GGNCC 4 cut(s) 161, 250, 787, 869
SchI GAGTC 3 cut(s) 203, 309, 755
SduI GDGCHC 2 cut(s) 158, 442
SfaNI GCATC 1 cut(s) 413
SfcI CTRYAG 1 cut(s) 542
SinI GGWCC 3 cut(s) 161, 787, 869
SmiMI CAYNNNNRTG 1 cut(s) 323
SmlI CTYRAG 3 cut(s) 211, 818, 1029
SmoI CTYRAG 3 cut(s) 211, 818, 1029
Sse9I AATT 7 cut(s) 14, 331, 514, 584, 669, 738, 847
SseBI AGGCCT 1 cut(s) 1140
SsiI CCGC 5 cut(s) 58, 89, 296, 797, 1003
SspMI CTAG 1 cut(s) 951
StuI AGGCCT 1 cut(s) 1140
StyI CCWWGG 2 cut(s) 955, 1126
TaaI ACNGT 3 cut(s) 267, 546, 780
TaiI ACGT 1 cut(s) 147
TaqI TCGA 4 cut(s) 207, 289, 841, 990
TasI AATT 7 cut(s) 14, 331, 514, 584, 669, 738, 847
TatI WGTACW 1 cut(s) 780
TfiI GAWTC 2 cut(s) 286, 947
Tru1I TTAA 7 cut(s) 99, 243, 395, 810, 819, 962, 1156
Tru9I TTAA 7 cut(s) 99, 243, 395, 810, 819, 962, 1156
TscAI CASTG 2 cut(s) 163, 1072
TspDTI ATGAA 5 cut(s) 613, 690, 774, 842, 995
TspGWI ACGGA 1 cut(s) 882
TspRI CASTG 2 cut(s) 163, 1072
Van91I CCANNNNNTGG 2 cut(s) 360, 1045
Vha464I CTTAAG 1 cut(s) 818
VpaK11BI GGWCC 3 cut(s) 161, 787, 869
XagI CCTNNNNNAGG 1 cut(s) 1145
XapI RAATTY 3 cut(s) 669, 738, 847
XceI RCATGY 1 cut(s) 202
XmnI GAANNNNTTC 3 cut(s) 672, 847, 986
XspI CTAG 1 cut(s) 951
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.