Rh2AG610900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000560
Physical Location & Seq
Forward (+)
83718638 .. 83731668
13031 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG610900.1

Sequence Viewer

Length: 261 bp
ATGAATCAAATGAAAGATTGCAACATGGACTCTGGGATTCAAAGGAAACTAGGAGAGGTAGCTCGACATCAACTTCTCAGCCGAGGTTCGGCTAATACTAGTCGAGAATCGGATATGGGCTGGTCAATTAAGTCTGTCCTAGCTGAGGTCCTTTTGATCTTAGTCAAGGTTCGGCTCAATGGTGGGCCATCAAAAGTTAATTTGGGTGATATCACGGTTGGGGTGAAGCAAATTAGTTCACAAGTTATTAAACTCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.35

Weight (kDa)

9.89

Isoelectric Point (pI)

20.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000560)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21400 FvH4_1g29793 FvH4_2g35581 FvH4_4g18554 FvH4_6g21671
pyrus_communis pycom11g14070
rosa_chinensis RchiOBHm_Chr6g0263201
rosa_laevigata RLG00000001861 RLG00000002050 RLG00000018783 RLG00000022649 RLG00000030152
rosa_multiflora Rmu_co8107100.1_g000001 Rmu_sc0000805.1_g000009 Rmu_sc0001347.1_g000002 Rmu_sc0001896.1_g000004 Rmu_sc0002170.1_g000040 Rmu_sc0002413.1_g000005 Rmu_sc0002489.1_g000053 Rmu_sc0002942.1_g000015 Rmu_sc0003071.1_g000022 Rmu_sc0003623.1_g000021 Rmu_sc0004063.1_g000005 Rmu_sc0004574.1_g000014 Rmu_sc0004723.1_g000009 Rmu_sc0005177.1_g000013 Rmu_sc0005994.1_g000011 Rmu_sc0006163.1_g000006 Rmu_sc0006583.1_g000008 Rmu_sc0008303.1_g000005 Rmu_sc0009027.1_g000002 Rmu_sc0009027.1_g000003 Rmu_sc0011790.1_g000009 Rmu_sc0011833.1_g000005 Rmu_sc0013493.1_g000006 Rmu_sc0016701.1_g000002 Rmu_sc0022033.1_g000001 Rmu_sc0022185.1_g000001 Rmu_sc0027245.1_g000005 Rmu_sc0030292.1_g000002 Rmu_ssc0000242.1_g000003
rosa_roxburghii Rroxscaffold_1G00015200 Rroxscaffold_1G00059290 Rroxscaffold_2G00079850 Rroxscaffold_2G00079860 Rroxscaffold_2G00107520 Rroxscaffold_2G00123420 Rroxscaffold_2G00123430 Rroxscaffold_3G00265790 Rroxscaffold_5G00335960 Rroxscaffold_5G00338270 Rroxscaffold_5G00343980 Rroxscaffold_5G00343990
rosa_samantha Rh1AG036500 Rh1DG429900 Rh2AG172600 Rh2AG610900 Rh2BG180200 Rh2BG180300 Rh2BG340600 Rh2BG400300 Rh2BG468400 Rh2BG478200 Rh2BG612500 Rh2BG612600 Rh3BG290000 Rh3BG290100 Rh3BG345200 Rh3BG345300 Rh3BG359800 Rh3CG291300 Rh4CG156300 Rh4CG264600 Rh5AG430300 Rh5BG185400 Rh6DG198700 Rh7CG199900 Rh7CG200000 Rh7CG370300 Rh7CG370600 Rh7CG395500 Rh7DG405800 Rh7DG405900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 88, 145
AgsI TTSAA 1 cut(s) 41
AhlI ACTAGT 1 cut(s) 98
AluBI AGCT 2 cut(s) 62, 143
AluI AGCT 2 cut(s) 62, 143
AoxI GGCC 1 cut(s) 185
AspS9I GGNCC 2 cut(s) 148, 185
AsuHPI GGTGA 3 cut(s) 218, 235, 247
AvaII GGWCC 1 cut(s) 148
BbvCI CCTCAGC 1 cut(s) 144
BccI CCATC 1 cut(s) 196
BcuI ACTAGT 1 cut(s) 98
BfaI CTAG 3 cut(s) 50, 99, 140
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 2 cut(s) 148, 185
Bpu10I CCTNAGC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 82
Bsc4I CCNNNNNNNGG 2 cut(s) 88, 145
BseDI CCNNGG 1 cut(s) 82
BseLI CCNNNNNNNGG 2 cut(s) 88, 145
BseMII CTCAG 2 cut(s) 91, 135
BshFI GGCC 1 cut(s) 187
BslI CCNNNNNNNGG 2 cut(s) 88, 145
BsnI GGCC 1 cut(s) 187
Bsp143I GATC 1 cut(s) 156
BspANI GGCC 1 cut(s) 187
BspCNI CTCAG 2 cut(s) 90, 136
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 1 cut(s) 156
Bst4CI ACNGT 1 cut(s) 217
BstDEI CTNAG 3 cut(s) 77, 144, 160
BstENI CCTNNNNNAGG 1 cut(s) 143
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BsuRI GGCC 1 cut(s) 187
Cfr13I GGNCC 2 cut(s) 148, 185
CviAII CATG 1 cut(s) 25
CviJI RGCY 7 cut(s) 62, 81, 92, 120, 143, 175, 187
CviKI_1 RGCY 7 cut(s) 62, 81, 92, 120, 143, 175, 187
DdeI CTNAG 3 cut(s) 77, 144, 160
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
Eco32I GATATC 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 148
EcoNI CCTNNNNNAGG 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 148
EcoRV GATATC 1 cut(s) 211
FaeI CATG 1 cut(s) 28
FaiI YATR 2 cut(s) 26, 116
FatI CATG 1 cut(s) 24
FspBI CTAG 3 cut(s) 50, 99, 140
HaeIII GGCC 1 cut(s) 187
Hin1II CATG 1 cut(s) 28
HinfI GANTC 4 cut(s) 4, 29, 37, 107
HphI GGTGA 3 cut(s) 218, 235, 247
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 239
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4V TGCA 1 cut(s) 21
HpyF3I CTNAG 3 cut(s) 77, 144, 160
Hsp92II CATG 1 cut(s) 28
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 2 cut(s) 18, 106
MaeI CTAG 3 cut(s) 50, 99, 140
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MluCI AATT 3 cut(s) 126, 199, 231
MlyI GAGTC 1 cut(s) 23
MnlI CCTC 3 cut(s) 49, 77, 139
MseI TTAA 3 cut(s) 129, 198, 249
NdeII GATC 1 cut(s) 156
NlaIII CATG 1 cut(s) 28
NmeAIII GCCGAG 1 cut(s) 107
PfeI GAWTC 3 cut(s) 4, 37, 107
PleI GAGTC 1 cut(s) 23
PpsI GAGTC 1 cut(s) 23
PpuMI RGGWCCY 1 cut(s) 148
Psp5II RGGWCCY 1 cut(s) 148
PspPI GGNCC 2 cut(s) 148, 185
PspPPI RGGWCCY 1 cut(s) 148
SaqAI TTAA 3 cut(s) 129, 198, 249
Sau3AI GATC 1 cut(s) 156
Sau96I GGNCC 2 cut(s) 148, 185
SchI GAGTC 1 cut(s) 23
SetI ASST 7 cut(s) 60, 64, 88, 145, 150, 171, 260
SinI GGWCC 1 cut(s) 148
SpeI ACTAGT 1 cut(s) 98
Sse9I AATT 3 cut(s) 126, 199, 231
SspMI CTAG 3 cut(s) 50, 99, 140
TaaI ACNGT 1 cut(s) 217
TaqI TCGA 2 cut(s) 64, 103
TasI AATT 3 cut(s) 126, 199, 231
TfiI GAWTC 3 cut(s) 4, 37, 107
Tru1I TTAA 3 cut(s) 129, 198, 249
Tru9I TTAA 3 cut(s) 129, 198, 249
TspDTI ATGAA 2 cut(s) 17, 26
VpaK11BI GGWCC 1 cut(s) 148
XagI CCTNNNNNAGG 1 cut(s) 143
XspI CTAG 3 cut(s) 50, 99, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.