Rmu_sc0001896.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001896.1
OG0000560
Physical Location & Seq
Forward (+)
9299 .. 9784
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001896.1_g000004.1.cds

Sequence Viewer

Length: 486 bp
atgaaacgttttgatcaccatgtccgagaagaagaaaatcgtcagcaagcccaagcgaaccaagacttggccaaatggttagaagacactgacacagatgataaacaagaccagcatttagatgacttggatcttgaagtcgatgaccagggtgacaagggcatattggaggatgatgaaggcctattggatgaggatatgggcgattatgatgacataggggactatgaggaacatgttgactacaatgatgccgatcaggttcctgacatcccagcctccaatccacaggttgataacaccatcaacactttgaccgagacgagtgtgcaagcttcagccagggaggccgagggagctactatcccaatatctcaggacatcggtgactttagggtgaatatgattagcgttcggtcagcaactaagattgattttgacctggtgcaggaagagagagattcggatggtgtatatttttcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

161

Amino Acids

18.28

Weight (kDa)

4.05

Isoelectric Point (pI)

33.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000560)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21400 FvH4_1g29793 FvH4_2g35581 FvH4_4g18554 FvH4_6g21671
pyrus_communis pycom11g14070
rosa_chinensis RchiOBHm_Chr6g0263201
rosa_laevigata RLG00000001861 RLG00000002050 RLG00000018783 RLG00000022649 RLG00000030152
rosa_multiflora Rmu_co8107100.1_g000001 Rmu_sc0000805.1_g000009 Rmu_sc0001347.1_g000002 Rmu_sc0001896.1_g000004 Rmu_sc0002170.1_g000040 Rmu_sc0002413.1_g000005 Rmu_sc0002489.1_g000053 Rmu_sc0002942.1_g000015 Rmu_sc0003071.1_g000022 Rmu_sc0003623.1_g000021 Rmu_sc0004063.1_g000005 Rmu_sc0004574.1_g000014 Rmu_sc0004723.1_g000009 Rmu_sc0005177.1_g000013 Rmu_sc0005994.1_g000011 Rmu_sc0006163.1_g000006 Rmu_sc0006583.1_g000008 Rmu_sc0008303.1_g000005 Rmu_sc0009027.1_g000002 Rmu_sc0009027.1_g000003 Rmu_sc0011790.1_g000009 Rmu_sc0011833.1_g000005 Rmu_sc0013493.1_g000006 Rmu_sc0016701.1_g000002 Rmu_sc0022033.1_g000001 Rmu_sc0022185.1_g000001 Rmu_sc0027245.1_g000005 Rmu_sc0030292.1_g000002 Rmu_ssc0000242.1_g000003
rosa_roxburghii Rroxscaffold_1G00015200 Rroxscaffold_1G00059290 Rroxscaffold_2G00079850 Rroxscaffold_2G00079860 Rroxscaffold_2G00107520 Rroxscaffold_2G00123420 Rroxscaffold_2G00123430 Rroxscaffold_3G00265790 Rroxscaffold_5G00335960 Rroxscaffold_5G00338270 Rroxscaffold_5G00343980 Rroxscaffold_5G00343990
rosa_samantha Rh1AG036500 Rh1DG429900 Rh2AG172600 Rh2AG610900 Rh2BG180200 Rh2BG180300 Rh2BG340600 Rh2BG400300 Rh2BG468400 Rh2BG478200 Rh2BG612500 Rh2BG612600 Rh3BG290000 Rh3BG290100 Rh3BG345200 Rh3BG345300 Rh3BG359800 Rh3CG291300 Rh4CG156300 Rh4CG264600 Rh5AG430300 Rh5BG185400 Rh6DG198700 Rh7CG199900 Rh7CG200000 Rh7CG370300 Rh7CG370600 Rh7CG395500 Rh7DG405800 Rh7DG405900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 67
AclI AACGTT 1 cut(s) 7
AclWI GGATC 1 cut(s) 138
AcoI YGGCCR 1 cut(s) 69
AcuI CTGAAG 1 cut(s) 321
AfiI CCNNNNNNNGG 2 cut(s) 67, 448
AflIII ACRYGT 1 cut(s) 235
AgsI TTSAA 1 cut(s) 137
AjnI CCWGG 3 cut(s) 147, 341, 441
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AluBI AGCT 2 cut(s) 335, 359
AluI AGCT 2 cut(s) 335, 359
Alw26I GTCTC 1 cut(s) 314
AlwI GGATC 1 cut(s) 138
AoxI GGCC 3 cut(s) 69, 181, 348
AsuHPI GGTGA 4 cut(s) 8, 164, 398, 409
BalI TGGCCA 1 cut(s) 71
BbsI GAAGAC 1 cut(s) 90
BccI CCATC 2 cut(s) 311, 461
BciT130I CCWGG 3 cut(s) 149, 343, 443
BclI TGATCA 1 cut(s) 13
BcoDI GTCTC 1 cut(s) 314
BglI GCCNNNNNGGC 1 cut(s) 347
Bme1390I CCNGG 3 cut(s) 149, 343, 443
BmiI GGNNCC 1 cut(s) 264
BmrFI CCNGG 3 cut(s) 149, 343, 443
BmsI GCATC 1 cut(s) 241
BpiI GAAGAC 1 cut(s) 90
BsaBI GATNNNNATC 1 cut(s) 255
BsaJI CCNNGG 3 cut(s) 148, 342, 351
Bsc4I CCNNNNNNNGG 2 cut(s) 67, 448
Bse8I GATNNNNATC 1 cut(s) 255
BseBI CCWGG 3 cut(s) 149, 343, 443
BseDI CCNNGG 3 cut(s) 148, 342, 351
BseGI GGATG 4 cut(s) 178, 196, 270, 472
BseJI GATNNNNATC 1 cut(s) 255
BseLI CCNNNNNNNGG 2 cut(s) 67, 448
BseMII CTCAG 1 cut(s) 389
BseYI CCCAGC 1 cut(s) 274
BsgI GTGCAG 1 cut(s) 467
BshFI GGCC 3 cut(s) 71, 183, 350
BslFI GGGAC 1 cut(s) 236
BslI CCNNNNNNNGG 2 cut(s) 67, 448
BsmAI GTCTC 1 cut(s) 314
BsmBI CGTCTC 1 cut(s) 314
BsmFI GGGAC 1 cut(s) 236
BsnI GGCC 3 cut(s) 71, 183, 350
Bsp143I GATC 3 cut(s) 13, 130, 256
BspANI GGCC 3 cut(s) 71, 183, 350
BspCNI CTCAG 1 cut(s) 388
BspLI GGNNCC 1 cut(s) 264
BspPI GGATC 1 cut(s) 138
BssECI CCNNGG 3 cut(s) 148, 342, 351
BssMI GATC 3 cut(s) 13, 130, 256
Bst2UI CCWGG 3 cut(s) 149, 343, 443
Bst6I CTCTTC 1 cut(s) 447
BstC8I GCNNGC 2 cut(s) 48, 333
BstDEI CTNAG 3 cut(s) 375, 426, 483
BstENI CCTNNNNNAGG 1 cut(s) 446
BstF5I GGATG 4 cut(s) 178, 196, 270, 472
BstKTI GATC 3 cut(s) 16, 133, 259
BstMAI GTCTC 1 cut(s) 314
BstMBI GATC 3 cut(s) 13, 130, 256
BstMWI GCNNNNNNNGC 2 cut(s) 347, 356
BstNI CCWGG 3 cut(s) 149, 343, 443
BstNSI RCATGY 1 cut(s) 239
BstSCI CCNGG 3 cut(s) 147, 341, 441
BstV2I GAAGAC 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BsuRI GGCC 3 cut(s) 71, 183, 350
BtsCI GGATG 4 cut(s) 178, 196, 270, 472
BtsIMutI CAGTG 1 cut(s) 87
Cac8I GCNNGC 2 cut(s) 48, 333
CsiI ACCWGGT 1 cut(s) 441
CviAII CATG 2 cut(s) 20, 236
CviJI RGCY 8 cut(s) 50, 71, 183, 278, 335, 341, 350, 359
CviKI_1 RGCY 8 cut(s) 50, 71, 183, 278, 335, 341, 350, 359
DdeI CTNAG 3 cut(s) 375, 426, 483
DpnI GATC 3 cut(s) 15, 132, 258
DpnII GATC 3 cut(s) 13, 130, 256
EaeI YGGCCR 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 447
EarI CTCTTC 1 cut(s) 447
Eco147I AGGCCT 1 cut(s) 183
Eco57I CTGAAG 1 cut(s) 321
EcoNI CCTNNNNNAGG 1 cut(s) 446
EcoRII CCWGG 3 cut(s) 147, 341, 441
Esp3I CGTCTC 1 cut(s) 314
FaeI CATG 2 cut(s) 23, 239
FaiI YATR 9 cut(s) 21, 164, 200, 210, 218, 228, 237, 404, 475
FaqI GGGAC 1 cut(s) 236
FatI CATG 2 cut(s) 19, 235
FbaI TGATCA 1 cut(s) 13
FokI GGATG 4 cut(s) 185, 203, 257, 479
GsaI CCCAGC 1 cut(s) 278
HaeIII GGCC 3 cut(s) 71, 183, 350
Hin1II CATG 2 cut(s) 23, 239
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HindIII AAGCTT 1 cut(s) 333
HinfI GANTC 1 cut(s) 461
HphI GGTGA 4 cut(s) 8, 164, 398, 409
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 26, 466
Hpy188III TCNNGA 3 cut(s) 134, 266, 377
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 173
HpyCH4IV ACGT 1 cut(s) 7
HpyCH4V TGCA 2 cut(s) 331, 448
HpyF10VI GCNNNNNNNGC 2 cut(s) 347, 356
HpyF3I CTNAG 3 cut(s) 375, 426, 483
HpySE526I ACGT 1 cut(s) 7
Hsp92II CATG 2 cut(s) 23, 239
Ksp22I TGATCA 1 cut(s) 13
Kzo9I GATC 3 cut(s) 13, 130, 256
LmnI GCTCC 1 cut(s) 356
LweI GCATC 1 cut(s) 241
MabI ACCWGGT 1 cut(s) 441
MaeII ACGT 1 cut(s) 7
MaeIII GTNAC 2 cut(s) 152, 386
MalI GATC 3 cut(s) 15, 132, 258
MboI GATC 3 cut(s) 13, 130, 256
MboII GAAGA 4 cut(s) 41, 44, 95, 464
MflI RGATCY 1 cut(s) 130
MlsI TGGCCA 1 cut(s) 71
MluNI TGGCCA 1 cut(s) 71
MnlI CCTC 6 cut(s) 163, 187, 223, 289, 340, 346
Mox20I TGGCCA 1 cut(s) 71
MscI TGGCCA 1 cut(s) 71
MslI CAYNNNNRTG 1 cut(s) 120
Msp20I TGGCCA 1 cut(s) 71
MspR9I CCNGG 3 cut(s) 149, 343, 443
MvaI CCWGG 3 cut(s) 149, 343, 443
MwoI GCNNNNNNNGC 2 cut(s) 347, 356
NdeII GATC 3 cut(s) 13, 130, 256
NlaIII CATG 2 cut(s) 23, 239
NlaIV GGNNCC 1 cut(s) 264
NmeAIII GCCGAG 1 cut(s) 376
NmuCI GTSAC 2 cut(s) 152, 386
NspI RCATGY 1 cut(s) 239
PceI AGGCCT 1 cut(s) 183
PciI ACATGT 1 cut(s) 235
PfeI GAWTC 1 cut(s) 461
PflMI CCANNNNNTGG 1 cut(s) 67
PscI ACATGT 1 cut(s) 235
Psp1406I AACGTT 1 cut(s) 7
Psp6I CCWGG 3 cut(s) 147, 341, 441
PspFI CCCAGC 1 cut(s) 274
PspGI CCWGG 3 cut(s) 147, 341, 441
PspN4I GGNNCC 1 cut(s) 264
PsuI RGATCY 1 cut(s) 130
RseI CAYNNNNRTG 1 cut(s) 120
Sau3AI GATC 3 cut(s) 13, 130, 256
ScrFI CCNGG 3 cut(s) 149, 343, 443
SetI ASST 6 cut(s) 10, 264, 294, 337, 361, 444
SexAI ACCWGGT 1 cut(s) 441
SfaNI GCATC 1 cut(s) 241
SmiMI CAYNNNNRTG 1 cut(s) 120
SseBI AGGCCT 1 cut(s) 183
StuI AGGCCT 1 cut(s) 183
StyD4I CCNGG 3 cut(s) 147, 341, 441
TaiI ACGT 1 cut(s) 10
TaqI TCGA 1 cut(s) 141
TaqII GACCGA 2 cut(s) 332, 405
TfiI GAWTC 1 cut(s) 461
TscAI CASTG 1 cut(s) 94
TseFI GTSAC 2 cut(s) 152, 386
Tsp45I GTSAC 2 cut(s) 152, 386
TspDTI ATGAA 2 cut(s) 17, 192
TspRI CASTG 1 cut(s) 94
Van91I CCANNNNNTGG 1 cut(s) 67
XagI CCTNNNNNAGG 1 cut(s) 446
XceI RCATGY 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.