Rmu_sc0008453.1_g000008

ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008453.1
OG0000404
Physical Location & Seq
Forward (+)
23797 .. 24438
642 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008453.1_g000008.1.cds

Sequence Viewer

Length: 642 bp
atggagattagaaaggatcatgatggagataatacactaagactcttccacgcatcagtggaaggatcaatttcatcgctgaacactttgatccaaaccgatccactactcctcagaagagtttctctgactacattgagtgaaaccccattgcatatttcagctttgcttggccaccttgaattttccaaaatcattctcactcataatccaagactcgccacggagttggactccttaaggcgctctcccctgcacttggcttcggcagaaggacacaaggagctcgtacaagctttgcttgcatttcctgatgcatgcttgttttatgatcaggaggggagaatccctctgcactatgccaccatgagaggacgagttgaggtggtcaaggagttgatccgtgcaaagcctcagtccgttgcccttgaggttctggatagatcaggagaaacaagtttgcatttatgtgttaaacacaaccgtctggactgcttgagaatttttgtaaaagaagtgggagaggatagcgacagactcaactcaggaactcgctctgatgctagcatgacaatcctgcggttagctatgatgctaaggcaaattgaggtacgcatcttttcctttttctttgcacaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_3 Ank_4 PGG

Protein Analysis

213

Amino Acids

24.09

Weight (kDa)

6.8

Isoelectric Point (pI)

53.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000404)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G13950 AT4G13266
fragaria_vesca FvH4_7g06240 FvH4_7g06250 FvH4_7g06270
malus_domestica MD12G1213300.v1.1 MD12G1213900.v1.1 MD12G1214100.v1.1 MD12G1214700.v1.1 MD12G1214800.v1.1
prunus_persica Prupe.2G107700_v2.0.a1 Prupe.3G142200_v2.0.a1 Prupe.3G154100_v2.0.a1 Prupe.3G154300_v2.0.a1 Prupe.3G154900_v2.0.a1 Prupe.3G155100_v2.0.a1
pyrus_communis pycom12g20010 pycom12g20080 pycom12g20090 pycom12g20100
rosa_chinensis RchiOBHm_Chr1g0341001 RchiOBHm_Chr1g0341021 RchiOBHm_Chr1g0341891 RchiOBHm_Chr1g0342341 RchiOBHm_Chr3g0490431
rosa_laevigata RLG00000022889 RLG00000029016 RLG00000029039 RLG00000029059 RLG00000029061 RLG00000029065 RLG00000029115 RLG00000029155 RLG00000033311 RLG00000033312
rosa_multiflora Rmu_sc0000404.1_g000006 Rmu_sc0001836.1_g000015 Rmu_sc0001836.1_g000050 Rmu_sc0002200.1_g000003 Rmu_sc0003862.1_g000020 Rmu_sc0005193.1_g000001 Rmu_sc0005193.1_g000002 Rmu_sc0008453.1_g000008 Rmu_sc0008453.1_g000009 Rmu_sc0008453.1_g000010 Rmu_sc0008862.1_g000001 Rmu_sc0011195.1_g000003 Rmu_sc0014077.1_g000001
rosa_roxburghii Rroxscaffold_4G00311670 Rroxscaffold_4G00311730 Rroxscaffold_4G00311750 Rroxscaffold_4G00312290 Rroxscaffold_6G00393430
rosa_rugosa Rorug01G0153800.1 Rorug01G0153900.1 Rorug01G0160100.1 Rorug03G0243800
rosa_samantha Rh1AG166400 Rh1AG168200 Rh1AG174100 Rh1AG174700 Rh1AG179000 Rh1BG132600 Rh1BG136500 Rh1BG142200 Rh1BG142800 Rh1BG143200 Rh1BG146200 Rh1BG147000 Rh1BG147100 Rh1CG154800 Rh1CG161900 Rh1CG162700 Rh1CG166000 Rh1DG167500 Rh1DG169900 Rh1DG174000 Rh1DG174400 Rh1DG174700 Rh1DG174800 Rh1DG178200 Rh1DG179000 Rh1DG179100 Rh3AG292800 Rh3BG329600 Rh3CG326900 Rh3DG326200 Rh5BG218300 Rh7CG326800 Rh7DG307100
rosa_wichuraiana Rw0G006190 Rw0G007830 Rw0G009970 Rw0G009980 Rw1G013880 Rw1G014000 Rw1G014500 Rw1G014560 Rw1G014920 Rw3G025950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 580
AclWI GGATC 5 cut(s) 24, 73, 85, 95, 394
AcoI YGGCCR 1 cut(s) 172
AcsI RAATTY 2 cut(s) 182, 501
AfaI GTAC 2 cut(s) 291, 612
AfiI CCNNNNNNNGG 1 cut(s) 259
AflII CTTAAG 1 cut(s) 238
AgsI TTSAA 1 cut(s) 182
AluBI AGCT 4 cut(s) 164, 286, 296, 587
AluI AGCT 4 cut(s) 164, 286, 296, 587
Alw21I GWGCWC 1 cut(s) 288
AlwI GGATC 5 cut(s) 24, 73, 85, 95, 394
AoxI GGCC 1 cut(s) 172
ApoI RAATTY 2 cut(s) 182, 501
ArsI GACNNNNNNTTYG 2 cut(s) 401, 433
Asp700I GAANNNNTTC 1 cut(s) 121
AspLEI GCGC 1 cut(s) 246
AsuNHI GCTAGC 1 cut(s) 563
BalI TGGCCA 1 cut(s) 174
BanII GRGCYC 1 cut(s) 288
Bbv12I GWGCWC 1 cut(s) 288
BccI CCATC 1 cut(s) 17
BclI TGATCA 1 cut(s) 331
BfaI CTAG 1 cut(s) 564
BfoI RGCGCY 1 cut(s) 247
BfrI CTTAAG 1 cut(s) 238
BmsI GCATC 5 cut(s) 62, 304, 550, 582, 624
BmtI GCTAGC 1 cut(s) 567
BplI GAGNNNNNCTC 4 cut(s) 218, 250, 334, 366
Bpu10I CCTNAGC 1 cut(s) 596
BpuEI CTTGAG 2 cut(s) 449, 517
BsaJI CCNNGG 1 cut(s) 222
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse3DI GCAATG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 259
BseMI GCAATG 1 cut(s) 149
BseMII CTCAG 3 cut(s) 127, 428, 558
BseRI GAGGAG 1 cut(s) 101
BsgI GTGCAG 2 cut(s) 239, 338
BshFI GGCC 1 cut(s) 174
BsiHKAI GWGCWC 1 cut(s) 288
BslI CCNNNNNNNGG 1 cut(s) 259
BsnI GGCC 1 cut(s) 174
Bsp1286I GDGCHC 1 cut(s) 288
Bsp143I GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
BspACI CCGC 1 cut(s) 580
BspANI GGCC 1 cut(s) 174
BspCNI CTCAG 3 cut(s) 126, 427, 557
BspHI TCATGA 1 cut(s) 19
BspOI GCTAGC 1 cut(s) 567
BspPI GGATC 5 cut(s) 24, 73, 85, 95, 394
BspTI CTTAAG 1 cut(s) 238
BsrDI GCAATG 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 222
BssMI GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
Bst4CI ACNGT 1 cut(s) 485
Bst6I CTCTTC 2 cut(s) 50, 112
BstAFI CTTAAG 1 cut(s) 238
BstC8I GCNNGC 3 cut(s) 303, 319, 565
BstDEI CTNAG 5 cut(s) 38, 113, 414, 544, 596
BstDSI CCRYGG 1 cut(s) 222
BstH2I RGCGCY 1 cut(s) 247
BstHHI GCGC 1 cut(s) 246
BstKTI GATC 7 cut(s) 19, 68, 93, 103, 334, 402, 446
BstMBI GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
BstMWI GCNNNNNNNGC 1 cut(s) 302
BstNSI RCATGY 1 cut(s) 321
BstXI CCANNNNNNTGG 1 cut(s) 229
BsuRI GGCC 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 222
BtgZI GCGATG 1 cut(s) 60
BtsIMutI CAGTG 1 cut(s) 63
Cac8I GCNNGC 3 cut(s) 303, 319, 565
CciI TCATGA 1 cut(s) 19
CfoI GCGC 1 cut(s) 246
Csp6I GTAC 2 cut(s) 290, 611
CviAII CATG 4 cut(s) 20, 318, 367, 568
CviJI RGCY 7 cut(s) 164, 174, 263, 286, 296, 412, 587
CviKI_1 RGCY 7 cut(s) 164, 174, 263, 286, 296, 412, 587
CviQI GTAC 2 cut(s) 290, 611
DdeI CTNAG 5 cut(s) 38, 113, 414, 544, 596
DpnI GATC 7 cut(s) 18, 67, 92, 102, 333, 401, 445
DpnII GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
EaeI YGGCCR 1 cut(s) 172
Eam1104I CTCTTC 2 cut(s) 50, 112
EarI CTCTTC 2 cut(s) 50, 112
Ecl136II GAGCTC 1 cut(s) 286
Eco24I GRGCYC 1 cut(s) 288
Eco53kI GAGCTC 1 cut(s) 286
EcoICRI GAGCTC 1 cut(s) 286
EcoT22I ATGCAT 1 cut(s) 319
EcoT38I GRGCYC 1 cut(s) 288
FaeI CATG 4 cut(s) 23, 321, 370, 571
FalI AAGNNNNNCTT 2 cut(s) 285, 317
FatI CATG 4 cut(s) 19, 317, 366, 567
FbaI TGATCA 1 cut(s) 331
FriOI GRGCYC 1 cut(s) 288
FspBI CTAG 1 cut(s) 564
GlaI GCGC 1 cut(s) 245
HaeII RGCGCY 1 cut(s) 247
HaeIII GGCC 1 cut(s) 174
HhaI GCGC 1 cut(s) 246
Hin1II CATG 4 cut(s) 23, 321, 370, 571
Hin6I GCGC 1 cut(s) 244
HinP1I GCGC 1 cut(s) 244
HindIII AAGCTT 1 cut(s) 294
HinfI GANTC 5 cut(s) 42, 216, 233, 345, 537
Hpy188I TCNGA 3 cut(s) 116, 129, 559
Hpy188III TCNNGA 7 cut(s) 20, 311, 335, 437, 447, 488, 546
HpyAV CCTTC 2 cut(s) 56, 266
HpyCH4III ACNGT 1 cut(s) 485
HpyCH4V TGCA 8 cut(s) 154, 256, 305, 317, 355, 407, 463, 635
HpyF10VI GCNNNNNNNGC 1 cut(s) 302
HpyF3I CTNAG 5 cut(s) 38, 113, 414, 544, 596
Hsp92II CATG 4 cut(s) 23, 321, 370, 571
HspAI GCGC 1 cut(s) 244
Ksp22I TGATCA 1 cut(s) 331
Kzo9I GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 8 cut(s) 266, 320, 324, 422, 432, 473, 531, 590
LweI GCATC 5 cut(s) 62, 304, 550, 582, 624
MaeI CTAG 1 cut(s) 564
MalI GATC 7 cut(s) 18, 67, 92, 102, 333, 401, 445
MboI GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
MboII GAAGA 2 cut(s) 37, 129
MhlI GDGCHC 1 cut(s) 288
MlsI TGGCCA 1 cut(s) 174
MluCI AATT 4 cut(s) 69, 182, 501, 603
MluNI TGGCCA 1 cut(s) 174
MlyI GAGTC 4 cut(s) 36, 210, 227, 531
MmeI TCCRAC 1 cut(s) 210
MnlI CCTC 9 cut(s) 122, 331, 360, 365, 376, 423, 424, 517, 601
Mox20I TGGCCA 1 cut(s) 174
Mph1103I ATGCAT 1 cut(s) 319
MroXI GAANNNNTTC 1 cut(s) 121
MscI TGGCCA 1 cut(s) 174
MseI TTAA 2 cut(s) 239, 474
MslI CAYNNNNRTG 1 cut(s) 468
Msp20I TGGCCA 1 cut(s) 174
MspCI CTTAAG 1 cut(s) 238
MwoI GCNNNNNNNGC 1 cut(s) 302
NdeII GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
NheI GCTAGC 1 cut(s) 563
NlaIII CATG 4 cut(s) 23, 321, 370, 571
NsiI ATGCAT 1 cut(s) 319
NspI RCATGY 1 cut(s) 321
PaeI GCATGC 1 cut(s) 321
PagI TCATGA 1 cut(s) 19
PdmI GAANNNNTTC 1 cut(s) 121
PfeI GAWTC 1 cut(s) 345
PleI GAGTC 4 cut(s) 36, 210, 227, 531
PpsI GAGTC 4 cut(s) 36, 210, 227, 531
Psp124BI GAGCTC 1 cut(s) 288
RsaI GTAC 2 cut(s) 291, 612
RsaNI GTAC 2 cut(s) 290, 611
RseI CAYNNNNRTG 1 cut(s) 468
SacI GAGCTC 1 cut(s) 288
SaqAI TTAA 2 cut(s) 239, 474
Sau3AI GATC 7 cut(s) 16, 65, 90, 100, 331, 399, 443
SchI GAGTC 4 cut(s) 36, 210, 227, 531
SduI GDGCHC 1 cut(s) 288
SetI ASST 8 cut(s) 166, 180, 288, 298, 387, 435, 589, 612
SfaNI GCATC 5 cut(s) 62, 304, 550, 582, 624
SmiMI CAYNNNNRTG 1 cut(s) 468
SmlI CTYRAG 3 cut(s) 238, 428, 496
SmoI CTYRAG 3 cut(s) 238, 428, 496
SphI GCATGC 1 cut(s) 321
Sse9I AATT 4 cut(s) 69, 182, 501, 603
SsiI CCGC 1 cut(s) 580
SspMI CTAG 1 cut(s) 564
SstI GAGCTC 1 cut(s) 288
TaaI ACNGT 1 cut(s) 485
TasI AATT 4 cut(s) 69, 182, 501, 603
TfiI GAWTC 1 cut(s) 345
Tru1I TTAA 2 cut(s) 239, 474
Tru9I TTAA 2 cut(s) 239, 474
TscAI CASTG 1 cut(s) 63
TspDTI ATGAA 1 cut(s) 63
TspGWI ACGGA 3 cut(s) 239, 392, 409
TspRI CASTG 1 cut(s) 63
Vha464I CTTAAG 1 cut(s) 238
XapI RAATTY 2 cut(s) 182, 501
XceI RCATGY 1 cut(s) 321
XmnI GAANNNNTTC 1 cut(s) 121
XspI CTAG 1 cut(s) 564
Zsp2I ATGCAT 1 cut(s) 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.