Rmu_sc0011195.1_g000003

ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011195.1
OG0000404
Physical Location & Seq
Forward (+)
9310 .. 9957
648 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011195.1_g000003.1.cds

Sequence Viewer

Length: 648 bp
atggctactaaacaagatgaaggagacgcaatagagctagtctacaaggcagcagttgcggggtgcgtatctaccttaaacaaattgatcgaaacaagcccactcattcttagaaagttttctttgactactttcactgagactcccttgcatgtatctgctttgctcggccaccatgactttaccagaacccttctcactcataatcccaacctcgcgaaggagttggaatcttacagacgctcacctctccacttggcttctgccgagggccacgaggagatcgttcaagttttgttacatgcagatcatgtcgatgtctgcttgtttcatgatcaggatggcagaattccgcttcactattcagccatgagaggacgacttgaggtcctcaagaagttgatacgagcaaagccagagtccatatttgtttcggttctgaatagatcaagagaaacggctttgcacttgtgtgttaaatataatcaattggagtgcttgaaactgttagtcgaacatgtggtcgaacatgtgggtgaacaaaaatcagaattcctcaactcaaaagacactgttgggggccagactatcctgcacctagctttggttctgaagcaaactgaggtatgtaatatatggagaacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_3 Ank_4 PGG

Protein Analysis

215

Amino Acids

24.25

Weight (kDa)

6.7

Isoelectric Point (pI)

42.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000404)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G13950 AT4G13266
fragaria_vesca FvH4_7g06240 FvH4_7g06250 FvH4_7g06270
malus_domestica MD12G1213300.v1.1 MD12G1213900.v1.1 MD12G1214100.v1.1 MD12G1214700.v1.1 MD12G1214800.v1.1
prunus_persica Prupe.2G107700_v2.0.a1 Prupe.3G142200_v2.0.a1 Prupe.3G154100_v2.0.a1 Prupe.3G154300_v2.0.a1 Prupe.3G154900_v2.0.a1 Prupe.3G155100_v2.0.a1
pyrus_communis pycom12g20010 pycom12g20080 pycom12g20090 pycom12g20100
rosa_chinensis RchiOBHm_Chr1g0341001 RchiOBHm_Chr1g0341021 RchiOBHm_Chr1g0341891 RchiOBHm_Chr1g0342341 RchiOBHm_Chr3g0490431
rosa_laevigata RLG00000022889 RLG00000029016 RLG00000029039 RLG00000029059 RLG00000029061 RLG00000029065 RLG00000029115 RLG00000029155 RLG00000033311 RLG00000033312
rosa_multiflora Rmu_sc0000404.1_g000006 Rmu_sc0001836.1_g000015 Rmu_sc0001836.1_g000050 Rmu_sc0002200.1_g000003 Rmu_sc0003862.1_g000020 Rmu_sc0005193.1_g000001 Rmu_sc0005193.1_g000002 Rmu_sc0008453.1_g000008 Rmu_sc0008453.1_g000009 Rmu_sc0008453.1_g000010 Rmu_sc0008862.1_g000001 Rmu_sc0011195.1_g000003 Rmu_sc0014077.1_g000001
rosa_roxburghii Rroxscaffold_4G00311670 Rroxscaffold_4G00311730 Rroxscaffold_4G00311750 Rroxscaffold_4G00312290 Rroxscaffold_6G00393430
rosa_rugosa Rorug01G0153800.1 Rorug01G0153900.1 Rorug01G0160100.1 Rorug03G0243800
rosa_samantha Rh1AG166400 Rh1AG168200 Rh1AG174100 Rh1AG174700 Rh1AG179000 Rh1BG132600 Rh1BG136500 Rh1BG142200 Rh1BG142800 Rh1BG143200 Rh1BG146200 Rh1BG147000 Rh1BG147100 Rh1CG154800 Rh1CG161900 Rh1CG162700 Rh1CG166000 Rh1DG167500 Rh1DG169900 Rh1DG174000 Rh1DG174400 Rh1DG174700 Rh1DG174800 Rh1DG178200 Rh1DG179000 Rh1DG179100 Rh3AG292800 Rh3BG329600 Rh3CG326900 Rh3DG326200 Rh5BG218300 Rh7CG326800 Rh7DG307100
rosa_wichuraiana Rw0G006190 Rw0G007830 Rw0G009970 Rw0G009980 Rw1G013880 Rw1G014000 Rw1G014500 Rw1G014560 Rw1G014920 Rw3G025950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 42
AccII CGCG 1 cut(s) 218
AciI CCGC 2 cut(s) 59, 353
AcoI YGGCCR 1 cut(s) 169
AcsI RAATTY 2 cut(s) 348, 551
AcuI CTGAAG 1 cut(s) 632
AfiI CCNNNNNNNGG 2 cut(s) 220, 604
AflIII ACRYGT 2 cut(s) 517, 529
AgsI TTSAA 2 cut(s) 290, 502
AhdI GACNNNNNGTC 1 cut(s) 386
AleI CACNNNNGTG 1 cut(s) 471
AluBI AGCT 2 cut(s) 37, 602
AluI AGCT 2 cut(s) 37, 602
Alw26I GTCTC 2 cut(s) 18, 134
AoxI GGCC 3 cut(s) 169, 271, 580
ApeKI GCWGC 1 cut(s) 50
ApoI RAATTY 2 cut(s) 348, 551
ArsI GACNNNNNNTTYG 4 cut(s) 404, 436, 507, 539
Asp700I GAANNNNTTC 1 cut(s) 118
AspS9I GGNCC 3 cut(s) 271, 388, 580
AsuHPI GGTGA 2 cut(s) 237, 548
AvaII GGWCC 1 cut(s) 388
BauI CACGAG 1 cut(s) 275
BbvI GCAGC 1 cut(s) 62
BccI CCATC 1 cut(s) 335
BceAI ACGGC 1 cut(s) 474
BclI TGATCA 1 cut(s) 334
BcoDI GTCTC 2 cut(s) 18, 134
BfaI CTAG 2 cut(s) 38, 599
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
Bme18I GGWCC 1 cut(s) 388
BmeRI GACNNNNNGTC 1 cut(s) 386
BmgT120I GGNCC 3 cut(s) 271, 388, 580
BmiI GGNNCC 1 cut(s) 581
BpuEI CTTGAG 2 cut(s) 377, 404
BsaJI CCNNGG 1 cut(s) 267
BsaXI ACNNNNNCTCC 2 cut(s) 127, 157
Bsc4I CCNNNNNNNGG 2 cut(s) 220, 604
BseDI CCNNGG 1 cut(s) 267
BseGI GGATG 1 cut(s) 346
BseLI CCNNNNNNNGG 2 cut(s) 220, 604
BseMII CTCAG 2 cut(s) 129, 612
BseRI GAGGAG 1 cut(s) 293
BseXI GCAGC 1 cut(s) 62
BsgI GTGCAG 1 cut(s) 578
Bsh1236I CGCG 1 cut(s) 218
BshFI GGCC 3 cut(s) 171, 273, 582
BslI CCNNNNNNNGG 2 cut(s) 220, 604
BsmAI GTCTC 2 cut(s) 18, 134
BsmBI CGTCTC 1 cut(s) 18
BsnI GGCC 3 cut(s) 171, 273, 582
Bsp143I GATC 5 cut(s) 87, 282, 307, 334, 446
Bsp68I TCGCGA 1 cut(s) 218
BspACI CCGC 2 cut(s) 59, 353
BspANI GGCC 3 cut(s) 171, 273, 582
BspCNI CTCAG 2 cut(s) 130, 613
BspFNI CGCG 1 cut(s) 218
BspHI TCATGA 1 cut(s) 331
BspLI GGNNCC 1 cut(s) 581
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 5 cut(s) 87, 282, 307, 334, 446
BssSI CACGAG 1 cut(s) 275
Bst2BI CACGAG 1 cut(s) 275
Bst4CI ACNGT 2 cut(s) 507, 574
BstAPI GCANNNNNTGC 1 cut(s) 56
BstDEI CTNAG 3 cut(s) 110, 138, 621
BstENI CCTNNNNNAGG 1 cut(s) 218
BstF5I GGATG 1 cut(s) 346
BstFNI CGCG 1 cut(s) 218
BstKTI GATC 5 cut(s) 90, 285, 310, 337, 449
BstMAI GTCTC 2 cut(s) 18, 134
BstMBI GATC 5 cut(s) 87, 282, 307, 334, 446
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNSI RCATGY 4 cut(s) 155, 305, 521, 533
BstUI CGCG 1 cut(s) 218
BstV1I GCAGC 1 cut(s) 62
BsuRI GGCC 3 cut(s) 171, 273, 582
BtsCI GGATG 1 cut(s) 346
BtsIMutI CAGTG 2 cut(s) 135, 570
BtuMI TCGCGA 1 cut(s) 218
CciI TCATGA 1 cut(s) 331
Cfr13I GGNCC 3 cut(s) 271, 388, 580
CseI GACGC 2 cut(s) 35, 249
CviAII CATG 8 cut(s) 152, 176, 302, 311, 332, 370, 518, 530
DdeI CTNAG 3 cut(s) 110, 138, 621
DpnI GATC 5 cut(s) 89, 284, 309, 336, 448
DpnII GATC 5 cut(s) 87, 282, 307, 334, 446
DriI GACNNNNNGTC 1 cut(s) 386
EaeI YGGCCR 1 cut(s) 169
Eam1105I GACNNNNNGTC 1 cut(s) 386
Eco47I GGWCC 1 cut(s) 388
Eco57I CTGAAG 1 cut(s) 632
EcoNI CCTNNNNNAGG 1 cut(s) 218
EcoO109I RGGNCCY 1 cut(s) 388
EcoRI GAATTC 2 cut(s) 348, 551
Esp3I CGTCTC 1 cut(s) 18
FaeI CATG 8 cut(s) 155, 179, 305, 314, 335, 373, 521, 533
FatI CATG 8 cut(s) 151, 175, 301, 310, 331, 369, 517, 529
FauI CCCGC 1 cut(s) 52
FbaI TGATCA 1 cut(s) 334
FblI GTMKAC 1 cut(s) 42
Fnu4HI GCNGC 1 cut(s) 51
FokI GGATG 1 cut(s) 353
Fsp4HI GCNGC 1 cut(s) 51
FspBI CTAG 2 cut(s) 38, 599
GluI GCNGC 1 cut(s) 51
HaeIII GGCC 3 cut(s) 171, 273, 582
HgaI GACGC 2 cut(s) 35, 249
Hin1II CATG 8 cut(s) 155, 179, 305, 314, 335, 373, 521, 533
HinfI GANTC 3 cut(s) 142, 230, 419
HphI GGTGA 2 cut(s) 237, 548
Hpy166II GTNNAC 2 cut(s) 43, 539
Hpy188I TCNGA 3 cut(s) 441, 550, 612
Hpy188III TCNNGA 5 cut(s) 217, 332, 338, 394, 450
Hpy8I GTNNAC 2 cut(s) 43, 539
HpyAV CCTTC 3 cut(s) 14, 203, 214
HpyCH4III ACNGT 2 cut(s) 507, 574
HpyCH4V TGCA 4 cut(s) 151, 305, 466, 595
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 3 cut(s) 110, 138, 621
Hsp92II CATG 8 cut(s) 155, 179, 305, 314, 335, 373, 521, 533
Ksp22I TGATCA 1 cut(s) 334
Kzo9I GATC 5 cut(s) 87, 282, 307, 334, 446
LpnPI CCDG 5 cut(s) 199, 323, 429, 596, 605
Lsp1109I GCAGC 1 cut(s) 62
MaeI CTAG 2 cut(s) 38, 599
MaeIII GTNAC 1 cut(s) 297
MalI GATC 5 cut(s) 89, 284, 309, 336, 448
MboI GATC 5 cut(s) 87, 282, 307, 334, 446
MfeI CAATTG 1 cut(s) 488
MluCI AATT 4 cut(s) 83, 348, 488, 551
MlyI GAGTC 2 cut(s) 136, 428
MmeI TCCRAC 1 cut(s) 207
MnlI CCTC 9 cut(s) 224, 258, 262, 271, 368, 379, 401, 566, 616
MroXI GAANNNNTTC 1 cut(s) 118
MseI TTAA 3 cut(s) 77, 477, 646
MslI CAYNNNNRTG 3 cut(s) 315, 471, 534
MunI CAATTG 1 cut(s) 488
MvnI CGCG 1 cut(s) 218
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeII GATC 5 cut(s) 87, 282, 307, 334, 446
NlaIII CATG 8 cut(s) 155, 179, 305, 314, 335, 373, 521, 533
NlaIV GGNNCC 1 cut(s) 581
NmeAIII GCCGAG 2 cut(s) 147, 292
NruI TCGCGA 1 cut(s) 218
NspI RCATGY 4 cut(s) 155, 305, 521, 533
OliI CACNNNNGTG 1 cut(s) 471
PagI TCATGA 1 cut(s) 331
PciI ACATGT 2 cut(s) 517, 529
PcsI WCGNNNNNNNCGW 1 cut(s) 282
PdmI GAANNNNTTC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 230
PkrI GCNGC 1 cut(s) 52
PleI GAGTC 2 cut(s) 136, 427
PpsI GAGTC 2 cut(s) 136, 427
PpuMI RGGWCCY 1 cut(s) 388
PscI ACATGT 2 cut(s) 517, 529
Psp5II RGGWCCY 1 cut(s) 388
PspN4I GGNNCC 1 cut(s) 581
PspPI GGNCC 3 cut(s) 271, 388, 580
PspPPI RGGWCCY 1 cut(s) 388
RruI TCGCGA 1 cut(s) 218
RseI CAYNNNNRTG 3 cut(s) 315, 471, 534
SaqAI TTAA 3 cut(s) 77, 477, 646
SatI GCNGC 1 cut(s) 51
Sau3AI GATC 5 cut(s) 87, 282, 307, 334, 446
Sau96I GGNCC 3 cut(s) 271, 388, 580
SchI GAGTC 2 cut(s) 136, 428
SetI ASST 8 cut(s) 39, 77, 216, 250, 390, 600, 604, 627
SinI GGWCC 1 cut(s) 388
SmiMI CAYNNNNRTG 3 cut(s) 315, 471, 534
SmlI CTYRAG 2 cut(s) 383, 392
SmoI CTYRAG 2 cut(s) 383, 392
Sse9I AATT 4 cut(s) 83, 348, 488, 551
SsiI CCGC 2 cut(s) 59, 353
SspMI CTAG 2 cut(s) 38, 599
TaaI ACNGT 2 cut(s) 507, 574
TaqI TCGA 4 cut(s) 90, 315, 513, 525
TasI AATT 4 cut(s) 83, 348, 488, 551
TfiI GAWTC 1 cut(s) 230
Tru1I TTAA 3 cut(s) 77, 477, 646
Tru9I TTAA 3 cut(s) 77, 477, 646
TscAI CASTG 2 cut(s) 142, 577
TseI GCWGC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 33, 320
TspRI CASTG 2 cut(s) 142, 577
VpaK11BI GGWCC 1 cut(s) 388
XagI CCTNNNNNAGG 1 cut(s) 218
XapI RAATTY 2 cut(s) 348, 551
XceI RCATGY 4 cut(s) 155, 305, 521, 533
XmiI GTMKAC 1 cut(s) 42
XmnI GAANNNNTTC 1 cut(s) 118
XspI CTAG 2 cut(s) 38, 599
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.