Rroxscaffold_5G00367160
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000469
Physical Location & Seq
Forward (+)
49038413 .. 49040271
1859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00367160.1

Sequence Viewer

Length: 183 bp
ATGCCAAGCTTTCCTTATGATAAACAAGTGAAAATAGTTATTGCTACAATAGCTCTTCATAACTACATAAGGAGATATGCTCAACAAGATGATGATTTTGATGAAAGTGAGAATTACTCAAGTGAAGAGATTAATGAAGAGATGGACGGCAATGCACATGAAGAAGATGGTCCGGGACGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

60

Amino Acids

6.98

Weight (kDa)

4.22

Isoelectric Point (pI)

81.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000469)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G43722 AT3G30525 AT5G28730
fragaria_vesca FvH4_1g10461 FvH4_1g19401 FvH4_2g04530 FvH4_2g04530 FvH4_2g11121 FvH4_2g13361 FvH4_3g21471 FvH4_3g26161 FvH4_3g29911 FvH4_4g20922 FvH4_4g30624 FvH4_5g23912 FvH4_6g30381 FvH4_6g53026 FvH4_7g00061 FvH4_7g19211 FvH4_7g19211
malus_domestica MD06G1090500.v1.1 MD08G1193900.v1.1 MD11G1151600.v1.1 MD16G1281600.v1.1
prunus_persica Prupe.1G096200_v2.0.a1 Prupe.1G189200_v2.0.a1 Prupe.1G198400_v2.0.a1 Prupe.6G167200_v2.0.a1 Prupe.6G192900_v2.0.a1
pyrus_communis pycom02g00900 pycom06g03500 pycom07g13740 pycom11g10040 pycom17g21680 pycom520g00090
rosa_chinensis RchiOBHm_Chr1g0354781 RchiOBHm_Chr2g0085491 RchiOBHm_Chr2g0103971 RchiOBHm_Chr2g0145791 RchiOBHm_Chr4g0414051 RchiOBHm_Chr4g0419691 RchiOBHm_Chr4g0435871 RchiOBHm_Chr6g0292381 RchiOBHm_Chr7g0199291
rosa_laevigata RLG00000035604
rosa_multiflora Rmu_co8287949.1_g000001 Rmu_sc0000079.1_g000057 Rmu_sc0000240.1_g000063 Rmu_sc0000552.1_g000020 Rmu_sc0000950.1_g000002 Rmu_sc0001257.1_g000003 Rmu_sc0001597.1_g000014 Rmu_sc0001939.1_g000006 Rmu_sc0002160.1_g000015 Rmu_sc0003526.1_g000015 Rmu_sc0005712.1_g000025 Rmu_sc0006032.1_g000011 Rmu_sc0006935.1_g000005 Rmu_sc0008636.1_g000002 Rmu_sc0009205.1_g000006 Rmu_sc0009438.1_g000007 Rmu_ssc0000486.1_g000013
rosa_roxburghii Rroxscaffold_1G00003870 Rroxscaffold_1G00014970 Rroxscaffold_3G00218750 Rroxscaffold_5G00367160 Rroxscaffold_7G00186480
rosa_rugosa Rorug05G0192000
rosa_samantha Rh4BG219200
rosa_wichuraiana Rw1G010350 Rw1G014480 Rw1G023690 Rw1G033480 Rw2G050290 Rw3G027480 Rw4G033650 Rw5G005670 Rw5G021010 Rw5G021860 Rw5G041260 Rw5G041760 Rw6G008410 Rw6G021080 Rw6G022950 Rw6G025480 Rw6G028700 Rw7G002710 Rw7G004940 Rw7G031510 Rw7G041110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 9, 53
AluI AGCT 2 cut(s) 9, 53
AseI ATTAAT 1 cut(s) 132
AspS9I GGNCC 1 cut(s) 170
AsuC2I CCSGG 1 cut(s) 174
AvaII GGWCC 1 cut(s) 170
BccI CCATC 2 cut(s) 136, 161
BceAI ACGGC 1 cut(s) 163
BcnI CCSGG 1 cut(s) 174
Bme1390I CCNGG 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmrFI CCNGG 1 cut(s) 174
BplI GAGNNNNNCTC 4 cut(s) 64, 96, 101, 133
BpuEI CTTGAG 1 cut(s) 103
BpuMI CCSGG 1 cut(s) 174
Bse3DI GCAATG 1 cut(s) 157
BseMI GCAATG 1 cut(s) 157
BsiSI CCGG 1 cut(s) 173
BspQI GCTCTTC 1 cut(s) 60
BsrDI GCAATG 1 cut(s) 157
Bst6I CTCTTC 3 cut(s) 60, 120, 132
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 170
CviAII CATG 1 cut(s) 158
CviJI RGCY 2 cut(s) 9, 53
CviKI_1 RGCY 2 cut(s) 9, 53
Eam1104I CTCTTC 3 cut(s) 60, 120, 132
EarI CTCTTC 3 cut(s) 60, 120, 132
Eco47I GGWCC 1 cut(s) 170
FaeI CATG 1 cut(s) 161
FaiI YATR 5 cut(s) 18, 60, 68, 78, 159
FalI AAGNNNNNCTT 1 cut(s) 30
FatI CATG 1 cut(s) 157
FspEI CC 8 cut(s) 18, 27, 55, 128, 132, 153, 158, 159
HapII CCGG 1 cut(s) 173
Hin1II CATG 1 cut(s) 161
HindIII AAGCTT 1 cut(s) 7
HpaII CCGG 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
Hsp92II CATG 1 cut(s) 161
LguI GCTCTTC 1 cut(s) 60
MboII GAAGA 5 cut(s) 47, 137, 149, 173, 176
MluCI AATT 1 cut(s) 112
MseI TTAA 1 cut(s) 132
MspI CCGG 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 50
NciI CCSGG 1 cut(s) 174
NlaIII CATG 1 cut(s) 161
PciSI GCTCTTC 1 cut(s) 60
PfoI TCCNGGA 1 cut(s) 172
PshBI ATTAAT 1 cut(s) 132
PspPI GGNCC 1 cut(s) 170
SapI GCTCTTC 1 cut(s) 60
SaqAI TTAA 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 174
SetI ASST 2 cut(s) 11, 55
SgeI CNNG 5 cut(s) 18, 38, 98, 132, 170
SinI GGWCC 1 cut(s) 170
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
Sse9I AATT 1 cut(s) 112
StyD4I CCNGG 1 cut(s) 172
TasI AATT 1 cut(s) 112
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 4 cut(s) 47, 117, 150, 174
VpaK11BI GGWCC 1 cut(s) 170
VspI ATTAAT 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.