FvH4_5g14271

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000607
Physical Location & Seq
Reverse (-)
8054801 .. 8055624
824 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g14271.t1

Sequence Viewer

Length: 219 bp
ATGGAACGTAAGAAGAAGAAGAAGAAGAATGACGCACAACAAGAAGGCCAGAAGAACAAACATCTCGAATCTCTCATCTATATATCTAGGGGTGGGCATAAAAAACCCGGCTTCGGAGGGGATGTGTACTCCGAGGTTAAGCATGTTGATGCTAGAGCAATCCCAGGATGGGTGACCTACTGGGAAGCTGCTCCTGAGCTGCCGGAAACAAAACCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.22

Weight (kDa)

9.56

Isoelectric Point (pI)

34.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 128
AfiI CCNNNNNNNGG 2 cut(s) 113, 169
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 2 cut(s) 188, 199
AluI AGCT 2 cut(s) 188, 199
AoxI GGCC 1 cut(s) 46
ApeKI GCWGC 2 cut(s) 188, 199
AsuC2I CCSGG 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 184
BbvI GCAGC 2 cut(s) 175, 186
BccI CCATC 1 cut(s) 162
BciT130I CCWGG 1 cut(s) 165
BcnI CCSGG 1 cut(s) 108
BfaI CTAG 2 cut(s) 87, 153
BisI GCNGC 2 cut(s) 189, 200
BlsI GCNGC 2 cut(s) 190, 201
Bme1390I CCNGG 2 cut(s) 108, 165
BmrFI CCNGG 2 cut(s) 108, 165
BmrI ACTGGG 1 cut(s) 190
BmsI GCATC 1 cut(s) 139
BmuI ACTGGG 1 cut(s) 190
Bpu10I CCTNAGC 1 cut(s) 195
BpuMI CCSGG 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 132, 163
BsaXI ACNNNNNCTCC 2 cut(s) 108, 138
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 169
Bse1I ACTGG 1 cut(s) 185
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 2 cut(s) 132, 163
BseGI GGATG 2 cut(s) 127, 173
BseLI CCNNNNNNNGG 2 cut(s) 113, 169
BseMII CTCAG 1 cut(s) 186
BseNI ACTGG 1 cut(s) 185
BseXI GCAGC 2 cut(s) 175, 186
BshFI GGCC 1 cut(s) 48
BsiSI CCGG 2 cut(s) 108, 203
BslI CCNNNNNNNGG 2 cut(s) 113, 169
BsnI GGCC 1 cut(s) 48
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 187
BsrI ACTGG 1 cut(s) 185
BssECI CCNNGG 2 cut(s) 132, 163
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 1 cut(s) 216
BstDEI CTNAG 1 cut(s) 195
BstEII GGTNACC 1 cut(s) 172
BstF5I GGATG 2 cut(s) 127, 173
BstNI CCWGG 1 cut(s) 165
BstNSI RCATGY 1 cut(s) 146
BstPI GGTNACC 1 cut(s) 172
BstSCI CCNGG 2 cut(s) 106, 163
BstV1I GCAGC 2 cut(s) 175, 186
BsuRI GGCC 1 cut(s) 48
BtsCI GGATG 2 cut(s) 127, 173
CseI GACGC 1 cut(s) 41
Csp6I GTAC 1 cut(s) 127
CviAII CATG 1 cut(s) 143
CviJI RGCY 4 cut(s) 48, 111, 188, 199
CviKI_1 RGCY 4 cut(s) 48, 111, 188, 199
CviQI GTAC 1 cut(s) 127
DdeI CTNAG 1 cut(s) 195
Eco91I GGTNACC 1 cut(s) 172
EcoO65I GGTNACC 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 163
FaeI CATG 1 cut(s) 146
FaiI YATR 4 cut(s) 81, 83, 99, 144
FatI CATG 1 cut(s) 142
Fnu4HI GCNGC 2 cut(s) 189, 200
FokI GGATG 2 cut(s) 134, 180
Fsp4HI GCNGC 2 cut(s) 189, 200
FspBI CTAG 2 cut(s) 87, 153
GluI GCNGC 2 cut(s) 189, 200
HaeIII GGCC 1 cut(s) 48
HapII CCGG 2 cut(s) 108, 203
HgaI GACGC 1 cut(s) 41
Hin1II CATG 1 cut(s) 146
HinfI GANTC 1 cut(s) 68
HpaII CCGG 2 cut(s) 108, 203
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 2 cut(s) 116, 133
Hpy188III TCNNGA 2 cut(s) 65, 194
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 38
HpyCH4III ACNGT 1 cut(s) 216
HpyCH4IV ACGT 1 cut(s) 7
HpyF3I CTNAG 1 cut(s) 195
HpySE526I ACGT 1 cut(s) 7
Hsp92II CATG 1 cut(s) 146
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 6 cut(s) 62, 121, 150, 166, 177, 207
Lsp1109I GCAGC 2 cut(s) 175, 186
LweI GCATC 1 cut(s) 139
MaeI CTAG 2 cut(s) 87, 153
MaeII ACGT 1 cut(s) 7
MaeIII GTNAC 1 cut(s) 172
MboII GAAGA 6 cut(s) 25, 28, 31, 34, 37, 64
MnlI CCTC 2 cut(s) 110, 127
MseI TTAA 1 cut(s) 138
MslI CAYNNNNRTG 1 cut(s) 147
MspI CCGG 2 cut(s) 108, 203
MspR9I CCNGG 2 cut(s) 108, 165
MvaI CCWGG 1 cut(s) 165
NciI CCSGG 1 cut(s) 108
NlaIII CATG 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 172
NspI RCATGY 1 cut(s) 146
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 2 cut(s) 190, 201
Psp6I CCWGG 1 cut(s) 163
PspEI GGTNACC 1 cut(s) 172
PspGI CCWGG 1 cut(s) 163
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 147
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 2 cut(s) 189, 200
ScrFI CCNGG 2 cut(s) 108, 165
SetI ASST 5 cut(s) 10, 138, 179, 190, 201
SfaNI GCATC 1 cut(s) 139
SmiMI CAYNNNNRTG 1 cut(s) 147
SspMI CTAG 2 cut(s) 87, 153
StyD4I CCNGG 2 cut(s) 106, 163
TaaI ACNGT 1 cut(s) 216
TaiI ACGT 1 cut(s) 10
TaqI TCGA 1 cut(s) 66
TatI WGTACW 1 cut(s) 126
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseFI GTSAC 1 cut(s) 172
TseI GCWGC 2 cut(s) 188, 199
Tsp45I GTSAC 1 cut(s) 172
XceI RCATGY 1 cut(s) 146
XspI CTAG 2 cut(s) 87, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.