Rmu_co8154324.1_g000001

Amidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8154324.1
OG0000427
Physical Location & Seq
Forward (+)
1 .. 654
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8154324.1_g000001.1.cds

Sequence Viewer

Length: 511 bp
gaggtgctgttttggtagacaatttggaaattgctaatttgactgaaatctattcttcaagcgatgaagatactgcattgtctgttgagtgcaaaatatccttaaatgcatacttgaaggagttggtggcttccccagtgcgatccttggcagatgttatagccttcaacaacaaacaccagaaactggaaaagatcaaggagtatgggcaagacctatttttagaagctgaagcaacaaatgggtttggaaaaacagagaagcgggcattgttgaatcttgcaaggtggacaagaattggtcttgtgaaattggtgacagagaagaagctagatgctgtagtgactcctaaagcagatttttcaaagatacttgcaattgggggagccccaggtctaatagttccagccggatacgagaacaatgggagaccagctggtatatgctttggtggacttcggggttcagagccaaagctaattgagattgcatatgcttttgagcaagctac
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00330 ko00360 ko00380 ko00627 ko00643 ko01120 map00330 map00360 map00380 map00627 map00643 map01120
Pfam Domains
Protein Families
Amidase

Protein Analysis

170

Amino Acids

18.35

Weight (kDa)

5.56

Isoelectric Point (pI)

36.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000427)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34880 AT4G34880
fragaria_vesca FvH4_2g01710 FvH4_2g01720 FvH4_2g01722
malus_domestica MD05G1117000.v1.1 MD05G1117200.v1.1 MD10G1120200.v1.1 MD10G1120300.v1.1 MD10G1120400.v1.1
prunus_persica Prupe.8G161600_v2.0.a1 Prupe.8G161700_v2.0.a1 Prupe.8G161700_v2.0.a1 Prupe.8G161800_v2.0.a1 Prupe.8G161900_v2.0.a1
pyrus_communis pycom05g06760 pycom10g10360 pycom10g10370 pycom17g11700
rosa_chinensis RchiOBHm_Chr6g0244611 RchiOBHm_Chr6g0244621 RchiOBHm_Chr6g0244631 RchiOBHm_Chr6g0244671 RchiOBHm_Chr6g0244701 RchiOBHm_Chr6g0244721 RchiOBHm_Chr6g0244741 RchiOBHm_Chr6g0244751
rosa_laevigata RLG00000015331 RLG00000015332 RLG00000015333 RLG00000015334 RLG00000015336 RLG00000015338 RLG00000015339 RLG00000015340
rosa_multiflora Rmu_co8154324.1_g000001 Rmu_co8259027.1_g000001 Rmu_co8319583.1_g000001 Rmu_sc0002064.1_g000004 Rmu_sc0002522.1_g000021 Rmu_sc0002522.1_g000022 Rmu_sc0002522.1_g000023 Rmu_sc0002522.1_g000026 Rmu_sc0002522.1_g000027 Rmu_sc0006257.1_g000002 Rmu_sc0006635.1_g000001 Rmu_sc0006635.1_g000002 Rmu_sc0007349.1_g000001 Rmu_sc0011292.1_g000009 Rmu_sc0011292.1_g000010 Rmu_sc0039466.1_g000001
rosa_roxburghii Rroxscaffold_7G00215530 Rroxscaffold_7G00215550 Rroxscaffold_7G00215560 Rroxscaffold_7G00215570 Rroxscaffold_7G00215610 Rroxscaffold_7G00215620 Rroxscaffold_7G00215630 Rroxscaffold_7G00215640
rosa_rugosa Rorug05G0509900 Rorug05G0510000 Rorug05G0510000 Rorug05G0510100 Rorug05G0510100 Rorug05G0510200 Rorug05G0510300 Rorug05G0510400
rosa_samantha Rh6BG020500 Rh6BG020600 Rh6BG020700 Rh6BG020900 Rh6BG021000 Rh6BG021100 Rh6BG021200 Rh6CG018800 Rh6CG019000 Rh6CG019100 Rh6CG019200 Rh6CG019300 Rh6CG019400 Rh6CG019600 Rh6CG019800 Rh6DG019900 Rh6DG020100 Rh6DG020200 Rh6DG020400
rosa_wichuraiana Rw0G014670 Rw6G000010 Rw6G000020 Rw6G002100 Rw6G002110 Rw6G002120 Rw6G002140 Rw6G002150 Rw6G002160 Rw6G005110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 186
AccI GTMKAC 1 cut(s) 17
AciI CCGC 1 cut(s) 264
AclWI GGATC 1 cut(s) 137
AcuI CTGAAG 1 cut(s) 251
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 5 cut(s) 59, 117, 168, 276, 365
AjnI CCWGG 1 cut(s) 390
AluBI AGCT 5 cut(s) 229, 330, 436, 477, 508
AluI AGCT 5 cut(s) 229, 330, 436, 477, 508
Alw26I GTCTC 1 cut(s) 423
AlwI GGATC 1 cut(s) 137
AlwNI CAGNNNCTG 1 cut(s) 186
AsuHPI GGTGA 1 cut(s) 327
BanII GRGCYC 1 cut(s) 390
BciT130I CCWGG 1 cut(s) 392
BciVI GTATCC 1 cut(s) 406
BcoDI GTCTC 1 cut(s) 423
BfaI CTAG 1 cut(s) 331
BfmI CTRYAG 1 cut(s) 338
BfuI GTATCC 1 cut(s) 406
Bme1390I CCNGG 1 cut(s) 392
BmiI GGNNCC 1 cut(s) 387
BmrFI CCNGG 1 cut(s) 392
BmrI ACTGGG 1 cut(s) 130
BmsI GCATC 1 cut(s) 324
BmuI ACTGGG 1 cut(s) 130
BsaI GGTCTC 1 cut(s) 423
BsaJI CCNNGG 2 cut(s) 146, 390
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse1I ACTGG 2 cut(s) 136, 191
BseBI CCWGG 1 cut(s) 392
BseDI CCNNGG 2 cut(s) 146, 390
BseLI CCNNNNNNNGG 1 cut(s) 186
BseNI ACTGG 2 cut(s) 136, 191
BsiSI CCGG 1 cut(s) 410
BslI CCNNNNNNNGG 1 cut(s) 186
BsmAI GTCTC 1 cut(s) 423
Bso31I GGTCTC 1 cut(s) 423
Bsp1286I GDGCHC 1 cut(s) 390
Bsp143I GATC 2 cut(s) 142, 194
BspACI CCGC 1 cut(s) 264
BspLI GGNNCC 1 cut(s) 387
BspPI GGATC 1 cut(s) 137
BspTNI GGTCTC 1 cut(s) 423
BsrI ACTGG 2 cut(s) 136, 191
BssECI CCNNGG 2 cut(s) 146, 390
BssMI GATC 2 cut(s) 142, 194
BssT1I CCWWGG 1 cut(s) 146
Bst2UI CCWGG 1 cut(s) 392
BstC8I GCNNGC 2 cut(s) 266, 506
BstKTI GATC 2 cut(s) 145, 197
BstMAI GTCTC 1 cut(s) 423
BstMBI GATC 2 cut(s) 142, 194
BstNI CCWGG 1 cut(s) 392
BstSCI CCNGG 1 cut(s) 390
BstSFI CTRYAG 1 cut(s) 338
BsuI GTATCC 1 cut(s) 406
BtgZI GCGATG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 143
Cac8I GCNNGC 2 cut(s) 266, 506
CaiI CAGNNNCTG 1 cut(s) 186
DpnI GATC 2 cut(s) 144, 196
DpnII GATC 2 cut(s) 142, 194
Eco130I CCWWGG 1 cut(s) 146
Eco24I GRGCYC 1 cut(s) 390
Eco31I GGTCTC 1 cut(s) 423
Eco57I CTGAAG 1 cut(s) 251
EcoRII CCWGG 1 cut(s) 390
EcoT14I CCWWGG 1 cut(s) 146
EcoT22I ATGCAT 1 cut(s) 111
EcoT38I GRGCYC 1 cut(s) 390
ErhI CCWWGG 1 cut(s) 146
FaiI YATR 7 cut(s) 111, 160, 206, 442, 444, 492, 494
FauI CCCGC 1 cut(s) 257
FauNDI CATATG 1 cut(s) 492
FblI GTMKAC 1 cut(s) 17
FriOI GRGCYC 1 cut(s) 390
FspBI CTAG 1 cut(s) 331
HapII CCGG 1 cut(s) 410
HinfI GANTC 2 cut(s) 276, 345
HpaII CCGG 1 cut(s) 410
HphI GGTGA 1 cut(s) 327
Hpy166II GTNNAC 3 cut(s) 18, 290, 454
Hpy188I TCNGA 1 cut(s) 468
Hpy8I GTNNAC 3 cut(s) 18, 290, 454
HpyAV CCTTC 2 cut(s) 111, 174
HpyCH4V TGCA 6 cut(s) 76, 92, 109, 283, 376, 490
Kzo9I GATC 2 cut(s) 142, 194
LmnI GCTCC 1 cut(s) 385
LpnPI CCDG 9 cut(s) 149, 172, 193, 377, 404, 419, 422, 423, 446
LweI GCATC 1 cut(s) 324
MaeI CTAG 1 cut(s) 331
MaeIII GTNAC 2 cut(s) 315, 342
MalI GATC 2 cut(s) 144, 196
MboI GATC 2 cut(s) 142, 194
MboII GAAGA 3 cut(s) 47, 79, 336
MfeI CAATTG 1 cut(s) 377
MhlI GDGCHC 1 cut(s) 390
MluCI AATT 7 cut(s) 21, 29, 36, 296, 310, 377, 479
MlyI GAGTC 1 cut(s) 339
Mph1103I ATGCAT 1 cut(s) 111
MseI TTAA 1 cut(s) 103
MspA1I CMGCKG 1 cut(s) 436
MspI CCGG 1 cut(s) 410
MspR9I CCNGG 1 cut(s) 392
MunI CAATTG 1 cut(s) 377
MvaI CCWGG 1 cut(s) 392
NdeI CATATG 1 cut(s) 492
NdeII GATC 2 cut(s) 142, 194
NlaIV GGNNCC 1 cut(s) 387
NmuCI GTSAC 2 cut(s) 315, 342
NsiI ATGCAT 1 cut(s) 111
PfeI GAWTC 1 cut(s) 276
PflMI CCANNNNNTGG 1 cut(s) 186
PleI GAGTC 1 cut(s) 339
PpsI GAGTC 1 cut(s) 339
Psp6I CCWGG 1 cut(s) 390
PspGI CCWGG 1 cut(s) 390
PspN4I GGNNCC 1 cut(s) 387
PstNI CAGNNNCTG 1 cut(s) 186
PvuII CAGCTG 1 cut(s) 436
SaqAI TTAA 1 cut(s) 103
Sau3AI GATC 2 cut(s) 142, 194
SchI GAGTC 1 cut(s) 339
ScrFI CCNGG 1 cut(s) 392
SduI GDGCHC 1 cut(s) 390
SetI ASST 9 cut(s) 6, 218, 231, 289, 332, 396, 438, 479, 510
SfaNI GCATC 1 cut(s) 324
SfcI CTRYAG 1 cut(s) 338
Sse9I AATT 7 cut(s) 21, 29, 36, 296, 310, 377, 479
SsiI CCGC 1 cut(s) 264
SspMI CTAG 1 cut(s) 331
StyD4I CCNGG 1 cut(s) 390
StyI CCWWGG 1 cut(s) 146
TasI AATT 7 cut(s) 21, 29, 36, 296, 310, 377, 479
TfiI GAWTC 1 cut(s) 276
Tru1I TTAA 1 cut(s) 103
Tru9I TTAA 1 cut(s) 103
TscAI CASTG 1 cut(s) 143
TseFI GTSAC 2 cut(s) 315, 342
Tsp45I GTSAC 2 cut(s) 315, 342
TspDTI ATGAA 1 cut(s) 80
TspRI CASTG 1 cut(s) 143
Van91I CCANNNNNTGG 1 cut(s) 186
XmiI GTMKAC 1 cut(s) 17
XspI CTAG 1 cut(s) 331
Zsp2I ATGCAT 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.