Rh6CG019600

Amidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000427
Physical Location & Seq
Reverse (-)
1883813 .. 1884109
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG019600.1

Sequence Viewer

Length: 297 bp
ATGGCTAACTATGTTCTCCTCTCGTTTTTGCTTCTAATTTGCATTCTATCATATGGCTCAGAAACACTTACAGCCAAAAGGCCCAAAATCACAATTGAAGAAGCTACTGTTGATGATCTCCAGCTTTCTTTCAAGCTCAACACTCTGACCTCAAGGCAACTTGTTCTGTTCTACCTGGACAAGATTCGAAAACTGAACAAAAACCTTAAGGGTGTGATAGAGGAGAACCCTGATGTGCTATCCCAAGCTGATAAAGCTGACAAACAAACGCAGAGAATGCAACCACACACTGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0016787 GO:0016810 GO:0016811
KEGG Pathways
Metabolic & Signaling
ko00330 ko00360 ko00380 ko00627 ko00643 ko01120 map00330 map00360 map00380 map00627 map00643 map01120
Pfam Domains
Protein Families
Amidase

Protein Analysis

98

Amino Acids

11.17

Weight (kDa)

8.76

Isoelectric Point (pI)

37.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000427)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34880 AT4G34880
fragaria_vesca FvH4_2g01710 FvH4_2g01720 FvH4_2g01722
malus_domestica MD05G1117000.v1.1 MD05G1117200.v1.1 MD10G1120200.v1.1 MD10G1120300.v1.1 MD10G1120400.v1.1
prunus_persica Prupe.8G161600_v2.0.a1 Prupe.8G161700_v2.0.a1 Prupe.8G161700_v2.0.a1 Prupe.8G161800_v2.0.a1 Prupe.8G161900_v2.0.a1
pyrus_communis pycom05g06760 pycom10g10360 pycom10g10370 pycom17g11700
rosa_chinensis RchiOBHm_Chr6g0244611 RchiOBHm_Chr6g0244621 RchiOBHm_Chr6g0244631 RchiOBHm_Chr6g0244671 RchiOBHm_Chr6g0244701 RchiOBHm_Chr6g0244721 RchiOBHm_Chr6g0244741 RchiOBHm_Chr6g0244751
rosa_laevigata RLG00000015331 RLG00000015332 RLG00000015333 RLG00000015334 RLG00000015336 RLG00000015338 RLG00000015339 RLG00000015340
rosa_multiflora Rmu_co8154324.1_g000001 Rmu_co8259027.1_g000001 Rmu_co8319583.1_g000001 Rmu_sc0002064.1_g000004 Rmu_sc0002522.1_g000021 Rmu_sc0002522.1_g000022 Rmu_sc0002522.1_g000023 Rmu_sc0002522.1_g000026 Rmu_sc0002522.1_g000027 Rmu_sc0006257.1_g000002 Rmu_sc0006635.1_g000001 Rmu_sc0006635.1_g000002 Rmu_sc0007349.1_g000001 Rmu_sc0011292.1_g000009 Rmu_sc0011292.1_g000010 Rmu_sc0039466.1_g000001
rosa_roxburghii Rroxscaffold_7G00215530 Rroxscaffold_7G00215550 Rroxscaffold_7G00215560 Rroxscaffold_7G00215570 Rroxscaffold_7G00215610 Rroxscaffold_7G00215620 Rroxscaffold_7G00215630 Rroxscaffold_7G00215640
rosa_rugosa Rorug05G0509900 Rorug05G0510000 Rorug05G0510000 Rorug05G0510100 Rorug05G0510100 Rorug05G0510200 Rorug05G0510300 Rorug05G0510400
rosa_samantha Rh6BG020500 Rh6BG020600 Rh6BG020700 Rh6BG020900 Rh6BG021000 Rh6BG021100 Rh6BG021200 Rh6CG018800 Rh6CG019000 Rh6CG019100 Rh6CG019200 Rh6CG019300 Rh6CG019400 Rh6CG019600 Rh6CG019800 Rh6DG019900 Rh6DG020100 Rh6DG020200 Rh6DG020400
rosa_wichuraiana Rw0G014670 Rw6G000010 Rw6G000020 Rw6G002100 Rw6G002110 Rw6G002120 Rw6G002140 Rw6G002150 Rw6G002160 Rw6G005110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 206
AgsI TTSAA 2 cut(s) 98, 133
AjnI CCWGG 1 cut(s) 174
AluBI AGCT 5 cut(s) 104, 124, 136, 248, 257
AluI AGCT 5 cut(s) 104, 124, 136, 248, 257
AoxI GGCC 1 cut(s) 80
AspS9I GGNCC 1 cut(s) 81
AsuII TTCGAA 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 176
BfrI CTTAAG 1 cut(s) 206
Bme1390I CCNGG 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 176
BpmI CTGGAG 1 cut(s) 104
Bpu14I TTCGAA 1 cut(s) 187
BpuEI CTTGAG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 176
BseMII CTCAG 1 cut(s) 72
BseRI GAGGAG 2 cut(s) 8, 236
BshFI GGCC 1 cut(s) 82
BsmI GAATGC 2 cut(s) 42, 282
BsnI GGCC 1 cut(s) 82
Bsp119I TTCGAA 1 cut(s) 187
Bsp143I GATC 1 cut(s) 115
BspANI GGCC 1 cut(s) 82
BspCNI CTCAG 1 cut(s) 71
BspT104I TTCGAA 1 cut(s) 187
BspTI CTTAAG 1 cut(s) 206
BssMI GATC 1 cut(s) 115
Bst2UI CCWGG 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 109
BstAFI CTTAAG 1 cut(s) 206
BstAPI GCANNNNNTGC 1 cut(s) 277
BstBI TTCGAA 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 58
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 2 cut(s) 254, 277
BstNI CCWGG 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 174
BsuRI GGCC 1 cut(s) 82
BtsI GCAGTG 1 cut(s) 288
BtsIMutI CAGTG 1 cut(s) 288
Cfr13I GGNCC 1 cut(s) 81
CviJI RGCY 9 cut(s) 5, 57, 74, 82, 104, 124, 136, 248, 257
CviKI_1 RGCY 9 cut(s) 5, 57, 74, 82, 104, 124, 136, 248, 257
DdeI CTNAG 1 cut(s) 58
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 174
FaiI YATR 3 cut(s) 12, 52, 54
FauNDI CATATG 1 cut(s) 52
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 1 cut(s) 82
HinfI GANTC 1 cut(s) 184
Hpy188I TCNGA 2 cut(s) 61, 147
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 42, 280
HpyF10VI GCNNNNNNNGC 2 cut(s) 254, 277
HpyF3I CTNAG 1 cut(s) 58
Kzo9I GATC 1 cut(s) 115
LpnPI CCDG 4 cut(s) 134, 161, 188, 243
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 1 cut(s) 110
MfeI CAATTG 1 cut(s) 93
MluCI AATT 2 cut(s) 36, 93
MnlI CCTC 3 cut(s) 29, 160, 214
MseI TTAA 1 cut(s) 207
MspCI CTTAAG 1 cut(s) 206
MspR9I CCNGG 1 cut(s) 176
MunI CAATTG 1 cut(s) 93
Mva1269I GAATGC 2 cut(s) 42, 282
MvaI CCWGG 1 cut(s) 176
MwoI GCNNNNNNNGC 2 cut(s) 254, 277
NdeI CATATG 1 cut(s) 52
NdeII GATC 1 cut(s) 115
NspV TTCGAA 1 cut(s) 187
PctI GAATGC 2 cut(s) 42, 282
PfeI GAWTC 1 cut(s) 184
Psp6I CCWGG 1 cut(s) 174
PspGI CCWGG 1 cut(s) 174
PspPI GGNCC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 1 cut(s) 115
Sau96I GGNCC 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 176
SetI ASST 8 cut(s) 106, 126, 138, 152, 177, 207, 250, 259
SfuI TTCGAA 1 cut(s) 187
SmlI CTYRAG 2 cut(s) 151, 206
SmoI CTYRAG 2 cut(s) 151, 206
Sse9I AATT 2 cut(s) 36, 93
StyD4I CCNGG 1 cut(s) 174
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 187
TasI AATT 2 cut(s) 36, 93
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TscAI CASTG 1 cut(s) 295
TspRI CASTG 1 cut(s) 295
Vha464I CTTAAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.